ID: 1194608133

View in Genome Browser
Species Human (GRCh38)
Location X:96006389-96006411
Sequence AGATTTAGACTCCAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194608133_1194608142 26 Left 1194608133 X:96006389-96006411 CCTCCCAACTGGAGTCTAAATCT No data
Right 1194608142 X:96006438-96006460 CAATAGGTCAATGCCTTCCCTGG No data
1194608133_1194608140 10 Left 1194608133 X:96006389-96006411 CCTCCCAACTGGAGTCTAAATCT No data
Right 1194608140 X:96006422-96006444 GGCACATGCAGGCCAGCAATAGG No data
1194608133_1194608137 -1 Left 1194608133 X:96006389-96006411 CCTCCCAACTGGAGTCTAAATCT No data
Right 1194608137 X:96006411-96006433 TACCTCCTACAGGCACATGCAGG No data
1194608133_1194608143 27 Left 1194608133 X:96006389-96006411 CCTCCCAACTGGAGTCTAAATCT No data
Right 1194608143 X:96006439-96006461 AATAGGTCAATGCCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194608133 Original CRISPR AGATTTAGACTCCAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr