ID: 1194613237

View in Genome Browser
Species Human (GRCh38)
Location X:96070025-96070047
Sequence TGTGACTTGCAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194613237_1194613240 3 Left 1194613237 X:96070025-96070047 CCTTTCTCCTTCTGCAAGTCACA No data
Right 1194613240 X:96070051-96070073 TTCTTTTCCATTAAATGTGGTGG No data
1194613237_1194613239 0 Left 1194613237 X:96070025-96070047 CCTTTCTCCTTCTGCAAGTCACA No data
Right 1194613239 X:96070048-96070070 AGATTCTTTTCCATTAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194613237 Original CRISPR TGTGACTTGCAGAAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr