ID: 1194614232

View in Genome Browser
Species Human (GRCh38)
Location X:96081750-96081772
Sequence TCGAATAGTTTCATAGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194614232_1194614236 3 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614236 X:96081776-96081798 AAAGATTGGGGAAATGCTTCAGG No data
1194614232_1194614238 29 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614238 X:96081802-96081824 TAGATCTATGCAAAGATTTAGGG No data
1194614232_1194614237 28 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614237 X:96081801-96081823 ATAGATCTATGCAAAGATTTAGG No data
1194614232_1194614234 -10 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614234 X:96081763-96081785 AACTATTCGACAAAAAGATTGGG No data
1194614232_1194614235 -9 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614235 X:96081764-96081786 ACTATTCGACAAAAAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194614232 Original CRISPR TCGAATAGTTTCATAGTTTT AGG (reversed) Intergenic
No off target data available for this crispr