ID: 1194614235

View in Genome Browser
Species Human (GRCh38)
Location X:96081764-96081786
Sequence ACTATTCGACAAAAAGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194614232_1194614235 -9 Left 1194614232 X:96081750-96081772 CCTAAAACTATGAAACTATTCGA No data
Right 1194614235 X:96081764-96081786 ACTATTCGACAAAAAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194614235 Original CRISPR ACTATTCGACAAAAAGATTG GGG Intergenic
No off target data available for this crispr