ID: 1194620994 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:96171660-96171682 |
| Sequence | GTGAATAAATGTATGATCAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194620991_1194620994 | 7 | Left | 1194620991 | X:96171630-96171652 | CCATAAAAGTTTGTTGAATGAAA | 0: 2 1: 1 2: 29 3: 233 4: 1095 |
||
| Right | 1194620994 | X:96171660-96171682 | GTGAATAAATGTATGATCAAAGG | No data | ||||
| 1194620990_1194620994 | 27 | Left | 1194620990 | X:96171610-96171632 | CCTTTACATACACTGGCATTCCA | No data | ||
| Right | 1194620994 | X:96171660-96171682 | GTGAATAAATGTATGATCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194620994 | Original CRISPR | GTGAATAAATGTATGATCAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||