ID: 1194620994

View in Genome Browser
Species Human (GRCh38)
Location X:96171660-96171682
Sequence GTGAATAAATGTATGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194620991_1194620994 7 Left 1194620991 X:96171630-96171652 CCATAAAAGTTTGTTGAATGAAA 0: 2
1: 1
2: 29
3: 233
4: 1095
Right 1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG No data
1194620990_1194620994 27 Left 1194620990 X:96171610-96171632 CCTTTACATACACTGGCATTCCA No data
Right 1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194620994 Original CRISPR GTGAATAAATGTATGATCAA AGG Intergenic
No off target data available for this crispr