ID: 1194624982

View in Genome Browser
Species Human (GRCh38)
Location X:96216575-96216597
Sequence CAGTTTCTTCAGAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194624982_1194624984 -9 Left 1194624982 X:96216575-96216597 CCATCCACACTCTGAAGAAACTG No data
Right 1194624984 X:96216589-96216611 AAGAAACTGTATCAACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194624982 Original CRISPR CAGTTTCTTCAGAGTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr