ID: 1194628332

View in Genome Browser
Species Human (GRCh38)
Location X:96252083-96252105
Sequence ATTCTATTCAGGAGCAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194628332_1194628335 -1 Left 1194628332 X:96252083-96252105 CCCTTTCTGCTCCTGAATAGAAT No data
Right 1194628335 X:96252105-96252127 TTTTATAATTTTTGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194628332 Original CRISPR ATTCTATTCAGGAGCAGAAA GGG (reversed) Intergenic
No off target data available for this crispr