ID: 1194635014

View in Genome Browser
Species Human (GRCh38)
Location X:96335290-96335312
Sequence TCCCTGAAGGGGAGATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194635014_1194635020 2 Left 1194635014 X:96335290-96335312 CCACCCAATCTCCCCTTCAGGGA No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194635014 Original CRISPR TCCCTGAAGGGGAGATTGGG TGG (reversed) Intergenic
No off target data available for this crispr