ID: 1194635020

View in Genome Browser
Species Human (GRCh38)
Location X:96335315-96335337
Sequence TATCCTTCAAACTATTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194635015_1194635020 -1 Left 1194635015 X:96335293-96335315 CCCAATCTCCCCTTCAGGGATTT No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data
1194635011_1194635020 21 Left 1194635011 X:96335271-96335293 CCATGGATGCTGTGATGTGCCAC No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data
1194635016_1194635020 -2 Left 1194635016 X:96335294-96335316 CCAATCTCCCCTTCAGGGATTTA No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data
1194635014_1194635020 2 Left 1194635014 X:96335290-96335312 CCACCCAATCTCCCCTTCAGGGA No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data
1194635017_1194635020 -9 Left 1194635017 X:96335301-96335323 CCCCTTCAGGGATTTATCCTTCA No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data
1194635018_1194635020 -10 Left 1194635018 X:96335302-96335324 CCCTTCAGGGATTTATCCTTCAA No data
Right 1194635020 X:96335315-96335337 TATCCTTCAAACTATTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194635020 Original CRISPR TATCCTTCAAACTATTAGAA AGG Intergenic
No off target data available for this crispr