ID: 1194639265

View in Genome Browser
Species Human (GRCh38)
Location X:96383102-96383124
Sequence CTGAATTAACAAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194639262_1194639265 23 Left 1194639262 X:96383056-96383078 CCAGCCTATAAAGCTCTTTTTGA No data
Right 1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG No data
1194639260_1194639265 29 Left 1194639260 X:96383050-96383072 CCACACCCAGCCTATAAAGCTCT No data
Right 1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG No data
1194639263_1194639265 19 Left 1194639263 X:96383060-96383082 CCTATAAAGCTCTTTTTGATTAG No data
Right 1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG No data
1194639261_1194639265 24 Left 1194639261 X:96383055-96383077 CCCAGCCTATAAAGCTCTTTTTG No data
Right 1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194639265 Original CRISPR CTGAATTAACAAAAGGAAGA AGG Intergenic
No off target data available for this crispr