ID: 1194645144

View in Genome Browser
Species Human (GRCh38)
Location X:96450288-96450310
Sequence CATATATTCCTCTGCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194645144_1194645149 -8 Left 1194645144 X:96450288-96450310 CCTCCTAAGCAGAGGAATATATG No data
Right 1194645149 X:96450303-96450325 AATATATGAAGAAATGGGATGGG No data
1194645144_1194645148 -9 Left 1194645144 X:96450288-96450310 CCTCCTAAGCAGAGGAATATATG No data
Right 1194645148 X:96450302-96450324 GAATATATGAAGAAATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194645144 Original CRISPR CATATATTCCTCTGCTTAGG AGG (reversed) Intergenic
No off target data available for this crispr