ID: 1194646438

View in Genome Browser
Species Human (GRCh38)
Location X:96464011-96464033
Sequence CAAACTAATTACAGTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194646431_1194646438 23 Left 1194646431 X:96463965-96463987 CCATATAAAGATAGGCTTATCCA No data
Right 1194646438 X:96464011-96464033 CAAACTAATTACAGTGATATTGG No data
1194646436_1194646438 3 Left 1194646436 X:96463985-96464007 CCAAAGGAGGAGAGGGAGAAAAA No data
Right 1194646438 X:96464011-96464033 CAAACTAATTACAGTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194646438 Original CRISPR CAAACTAATTACAGTGATAT TGG Intergenic
No off target data available for this crispr