ID: 1194649419

View in Genome Browser
Species Human (GRCh38)
Location X:96497840-96497862
Sequence AGTTATCTGTAGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194649419_1194649421 4 Left 1194649419 X:96497840-96497862 CCTGCCATTATCTACAGATAACT No data
Right 1194649421 X:96497867-96497889 TCTTTTTAAGAAATAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194649419 Original CRISPR AGTTATCTGTAGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr