ID: 1194665003

View in Genome Browser
Species Human (GRCh38)
Location X:96667712-96667734
Sequence AAACCAACCCTGCTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194665003_1194665005 -1 Left 1194665003 X:96667712-96667734 CCAGGCATCAGCAGGGTTGGTTT No data
Right 1194665005 X:96667734-96667756 TCTTCTGAGGCCTCTCTCATTGG 0: 5
1: 195
2: 621
3: 1140
4: 1473
1194665003_1194665007 12 Left 1194665003 X:96667712-96667734 CCAGGCATCAGCAGGGTTGGTTT No data
Right 1194665007 X:96667747-96667769 CTCTCATTGGCTTGCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194665003 Original CRISPR AAACCAACCCTGCTGATGCC TGG (reversed) Intergenic
No off target data available for this crispr