ID: 1194665668

View in Genome Browser
Species Human (GRCh38)
Location X:96674848-96674870
Sequence CATATTCCCCAATAGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194665660_1194665668 21 Left 1194665660 X:96674804-96674826 CCCTAGGTCAGGTTCCTGTAACT No data
Right 1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG No data
1194665665_1194665668 -6 Left 1194665665 X:96674831-96674853 CCCAGGCTGAACTAACACATATT No data
Right 1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG No data
1194665666_1194665668 -7 Left 1194665666 X:96674832-96674854 CCAGGCTGAACTAACACATATTC No data
Right 1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG No data
1194665661_1194665668 20 Left 1194665661 X:96674805-96674827 CCTAGGTCAGGTTCCTGTAACTG No data
Right 1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG No data
1194665664_1194665668 7 Left 1194665664 X:96674818-96674840 CCTGTAACTGGCACCCAGGCTGA No data
Right 1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194665668 Original CRISPR CATATTCCCCAATAGGAGAA CGG Intergenic
No off target data available for this crispr