ID: 1194666040

View in Genome Browser
Species Human (GRCh38)
Location X:96678603-96678625
Sequence AACTTTATCTAGTTTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194666034_1194666040 8 Left 1194666034 X:96678572-96678594 CCTTTGGGGCCACTCCAGTTCCA No data
Right 1194666040 X:96678603-96678625 AACTTTATCTAGTTTAAGCTGGG No data
1194666035_1194666040 -1 Left 1194666035 X:96678581-96678603 CCACTCCAGTTCCAATCCTCACA No data
Right 1194666040 X:96678603-96678625 AACTTTATCTAGTTTAAGCTGGG No data
1194666036_1194666040 -6 Left 1194666036 X:96678586-96678608 CCAGTTCCAATCCTCACAACTTT No data
Right 1194666040 X:96678603-96678625 AACTTTATCTAGTTTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194666040 Original CRISPR AACTTTATCTAGTTTAAGCT GGG Intergenic