ID: 1194670839

View in Genome Browser
Species Human (GRCh38)
Location X:96730699-96730721
Sequence CTAGAGTGTAACCTCCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1120
Summary {0: 1, 1: 1, 2: 16, 3: 171, 4: 931}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194670839 Original CRISPR CTAGAGTGTAACCTCCTTAA AGG Intronic
900753996 1:4420838-4420860 CTAGACTGTAAGCTCCATGAGGG - Intergenic
901279681 1:8024541-8024563 TTAGATTGTAAACTCCTTAAGGG - Intronic
902098649 1:13967021-13967043 CTAGACTTTAAACTTCTTAAAGG + Intergenic
902167190 1:14582002-14582024 CTAGAATGTAAGCTCCAAAAGGG + Intergenic
902909591 1:19585709-19585731 CTAGACTGTAAGCTCCATGAAGG - Intergenic
903314194 1:22488271-22488293 CTAGAATGTAAGCTCCATTAGGG - Intronic
903442451 1:23398490-23398512 CTAGACTGTAAGCCCCTTAAGGG - Intronic
903740472 1:25555856-25555878 CTAGAGTGGAAGCTCCTTGAGGG - Intronic
903794293 1:25917013-25917035 CTAGTGAGTAAACTCCTTCAGGG + Intergenic
903815570 1:26061861-26061883 CCAGACTGTAACCTCCATCAAGG + Intronic
903957517 1:27035515-27035537 CTAGAGTGTAAGCTCCATGAGGG + Intergenic
903978468 1:27167605-27167627 CTAGACTGTAAGCTCCTCAATGG + Intergenic
904100299 1:28020484-28020506 CTAGAATTTAAACTCCTTGAGGG - Intronic
904130181 1:28269945-28269967 CTAGAATGTAAGCTCCATAATGG - Intronic
904509366 1:30990265-30990287 CCAGATTGTAAGCTCCTTGAGGG - Intronic
905109819 1:35587181-35587203 CAAGGCTGTCACCTCCTTAAAGG + Intronic
905277433 1:36827588-36827610 CTAGACTGTAAGCTCCATGAGGG - Intronic
905766147 1:40602784-40602806 CTAGAATGTAAGTTCCATAATGG + Intergenic
905774957 1:40662479-40662501 CTAGAATGTCACCTCCGTGAGGG + Intronic
905784171 1:40739647-40739669 CTAGATTGTAAGCTCCTCACAGG - Intronic
906013184 1:42548938-42548960 CTAGATTTTAAGCTCCTTTAAGG + Intronic
906115527 1:43354346-43354368 CTAGATTGTGAGCTCCTTGAGGG + Intergenic
906135225 1:43495034-43495056 CTAGACTATAACCTCCATGAAGG - Intergenic
906164420 1:43675298-43675320 CTAGACTGTGAGCTCCTTGAAGG - Intronic
906300737 1:44679909-44679931 CTAGAGTGTGAGTTCCTCAAGGG - Intronic
906384478 1:45355621-45355643 ATAGATTGTGATCTCCTTAAAGG - Intronic
906547685 1:46632838-46632860 CTAGACTGTGAGCTCCTTGAGGG - Exonic
906628443 1:47344848-47344870 CTAGAGTGTAATGTCTTTAAGGG + Intronic
906789264 1:48644434-48644456 CTGGACTGTGAACTCCTTAAGGG + Intronic
906944286 1:50282585-50282607 CTAGATTGTAAGCTCCTTGAAGG - Intergenic
906947754 1:50309900-50309922 CTAGACCGTAAACTCCTTCAGGG - Intergenic
907395226 1:54185129-54185151 CTAGATTGTAAGCTCCTTAAGGG - Intronic
907419650 1:54338313-54338335 CTAGACTGTAAAATCCTTGAGGG + Intronic
907678719 1:56543216-56543238 CTAAAGTCTAAACTCCTTCAAGG - Intronic
907757605 1:57326098-57326120 CTAGACTGTGAGCTCCTTGAGGG - Intronic
907969235 1:59364618-59364640 CTAGACTGAAAGCTCCTCAAAGG - Intronic
908060622 1:60344320-60344342 CTAGTTTGTGAGCTCCTTAAAGG - Intergenic
908111157 1:60898991-60899013 CTGGATTGTAATCTCCTCAAAGG - Intronic
908123084 1:61004205-61004227 TTAGACTGTGAACTCCTTAAAGG + Intronic
908151035 1:61303318-61303340 CTAGAAGGTAAGCTCCTTGAGGG - Intronic
908338379 1:63150527-63150549 CTAGAATGTAAAGTCCATAAAGG - Intergenic
908475776 1:64486793-64486815 TAAGAATGTAAGCTCCTTAAAGG - Intronic
908497958 1:64713993-64714015 CTAGAATGTAAGCTCCATGAGGG + Intergenic
908577582 1:65477305-65477327 CTAGAATGTCAGCTCCATAAGGG + Intronic
908693562 1:66810706-66810728 CTAGACTGTAAGTTCCTTGAGGG - Intergenic
908864240 1:68528067-68528089 CTAGACTGTGAGCTCCTTGATGG - Intergenic
908901185 1:68958413-68958435 CAAGAGTGAAAACTTCTTAAAGG - Intergenic
909064691 1:70921192-70921214 CTAGATTGTAAGCTCCTTGAGGG - Intronic
909161210 1:72151403-72151425 ATTGAGTGTAAATTCCTTAAAGG - Intronic
909327311 1:74366975-74366997 CTACATTGTAAGCTTCTTAAGGG + Intronic
909350542 1:74647942-74647964 CTAGAGTGGAAGCTCCTATAGGG + Intronic
909469377 1:76009821-76009843 CTAGAGTGAAAGCTCCATGAGGG - Intergenic
909567311 1:77067423-77067445 TTAGATTGTAAGCTCCTTGAGGG + Intergenic
909652743 1:77993618-77993640 TTATAGTATAAACTCCTTAAGGG + Intronic
909689137 1:78386818-78386840 CAAGAATGTAAGCTCCATAAGGG - Intronic
909815809 1:79992477-79992499 TTAGACTGTAGTCTCCTTAAGGG - Intergenic
910155227 1:84209748-84209770 CTAGAATGTAAACTCCATGAAGG + Intronic
910260721 1:85291154-85291176 CTACAGTGTAAGCTCCAGAAGGG + Intergenic
910355419 1:86347313-86347335 CTAAACTGTAAGCTCCTTAAGGG - Exonic
910484629 1:87699845-87699867 CTAGACTGTAATCTCCCTGAAGG + Intergenic
910749837 1:90616942-90616964 CTAATGTGTAAATTCCTTAAAGG + Intergenic
910766240 1:90785285-90785307 CTAGAATGTAAGCTCCCTGAGGG + Intergenic
910769887 1:90820311-90820333 CCAAATTGTAACTTCCTTAAGGG + Intergenic
910852169 1:91659158-91659180 CTAGAATGTAAGCTCCATGAAGG + Intergenic
910918685 1:92319655-92319677 CTAGACTATAAGCTCCTTAAAGG - Intronic
911139642 1:94485325-94485347 CTAAAATGTAAGCTCCTTAAAGG - Intronic
911152455 1:94608547-94608569 CTAGACTGGAAGCTCCTGAAAGG - Intergenic
911201833 1:95051972-95051994 CTAGAATGTAGCCTCCATAAGGG + Intronic
911217092 1:95206779-95206801 CTAGATTATAAACTCCTTGAGGG - Intronic
911723619 1:101218606-101218628 CTAGAATGTAAGTTCCATAAAGG - Intergenic
911785225 1:101937929-101937951 CTAGAATGTAAACACCTCAAGGG + Intronic
912171660 1:107107877-107107899 CTAGAATGTAAGCTCCATGAGGG + Intergenic
912309765 1:108608563-108608585 CTAGAATGTAAGCTCTTTCAAGG + Intronic
912585353 1:110759124-110759146 CTAGACTATAAGCTTCTTAAGGG + Intergenic
912596353 1:110880755-110880777 CTAGAATGTGAGCTCCTTGAGGG - Intronic
912697672 1:111853673-111853695 CTAGAGTGTAAGCTCCATGCGGG + Intronic
912730290 1:112096290-112096312 CTAGACTGTAAGCTCCTTGAGGG - Intergenic
912748883 1:112268974-112268996 CTAGAACGTAAGCTCCTTGAGGG + Intergenic
912781085 1:112548388-112548410 TTAGATTGTAAACTCCTTGAAGG - Intronic
912808885 1:112778518-112778540 CTTGAGTGTGAGCTCCTTGAGGG - Intergenic
913059034 1:115187879-115187901 CTAGACTGTAAGCTCCATGAAGG + Intergenic
913460582 1:119082161-119082183 TTAGACTGTGAGCTCCTTAAGGG + Intronic
913478476 1:119261710-119261732 TTACAGTGTAAGCTCCTGAAGGG + Intergenic
913575950 1:120175239-120175261 CTAGACTGTAAGCTCCACAAAGG + Intronic
913689755 1:121268084-121268106 CTAGAGTGTAAGTTCCATGATGG - Intronic
914147844 1:145012188-145012210 CTAGAGTGTAAGTTCCATGATGG + Intronic
914452025 1:147800885-147800907 CTAGAATGTAAGCTCCATGAAGG + Intergenic
914558264 1:148790810-148790832 CTAGACTGTAAGCTCCACAAAGG + Intergenic
914614571 1:149339420-149339442 CTAGACTGTAAGCTCCACAAAGG - Intergenic
915040546 1:152964868-152964890 CCAGAGTGCAAGCTCCTTAAGGG - Intergenic
915468192 1:156110236-156110258 CTAGAATGTCAGCTCCATAAGGG + Intronic
915599937 1:156915744-156915766 CTAGACTGTAAGCTCCCTGAAGG + Exonic
915673331 1:157508926-157508948 CTAGAATGTCAGCTCCTTGAGGG + Intergenic
915736033 1:158085849-158085871 CTAAACTGTAAACTCCTTGAGGG - Intronic
915768430 1:158391677-158391699 CTAGAATATAAACTCCTTAAAGG - Intergenic
915902282 1:159855611-159855633 CTAGACTGTAAGCTCCTGGAGGG - Intronic
916156401 1:161853966-161853988 CTAGAGTGTAAGCTCCATTAAGG - Intronic
916421609 1:164642740-164642762 CTAGACTGTGAGCTCCTTGAAGG - Intronic
916452067 1:164930305-164930327 CTAGATTGTAAGCTCCTCAAGGG - Intergenic
916478942 1:165197806-165197828 CTAGATTGTAAACTCCTTGGAGG + Intergenic
916584511 1:166138760-166138782 CTAGAATGTCAACTCCATAAAGG + Intronic
916842812 1:168617256-168617278 CTAGTGTGTATCCTCCTTTAAGG + Intergenic
917225819 1:172781246-172781268 CTAGACTATAAGCTCCTTGAAGG - Intergenic
917306794 1:173634775-173634797 CTAGATTGTACACTCCTTAAAGG + Intronic
917436905 1:175031315-175031337 CTACAGTGTAAGCTCCATGAGGG - Intergenic
917539038 1:175895765-175895787 CTAGACTGTAAGCTCCCTGAGGG - Intergenic
917730201 1:177867497-177867519 CTAGAGTGTAAGCCCCATGAAGG - Intergenic
918361484 1:183763485-183763507 CTAAAATGTAAGCTCCTCAAGGG + Intronic
918585456 1:186182813-186182835 CTAGACTGTAAACTCTTAAAGGG - Intronic
919354095 1:196499374-196499396 TTAGAATGTAAACTCCATAAGGG + Intronic
919625550 1:199906749-199906771 CTAGACTGTAAATTCATTAAGGG - Intergenic
919628631 1:199937256-199937278 CTAGACTGTGAACTCCTTGAGGG + Intergenic
920313694 1:205063238-205063260 CTGGATTGTAAGCTACTTAAAGG - Intronic
920321446 1:205126256-205126278 CGAGAGTATAAGCTCCTTAAAGG + Intergenic
920370314 1:205474719-205474741 TTAGAGTGTAAGCTCCATGAGGG + Intergenic
920477076 1:206286558-206286580 CTAGAGTGTAAGTTCCATGATGG - Intronic
920537065 1:206744663-206744685 CTAGCATGTAACCTCCACAAGGG + Intergenic
920670019 1:207996544-207996566 CTAGGGTGTAAGCTCTTTGAGGG + Intergenic
920700714 1:208216411-208216433 CTAGCGTGTAATCTCCATGAGGG + Intronic
920706433 1:208254199-208254221 CTAGATTGCAAATTCCTTAAAGG + Intergenic
920786163 1:209043540-209043562 CTAGATTGTGAGATCCTTAAGGG + Intergenic
920868611 1:209774337-209774359 CTGGATTGTAAACTCCTTCAGGG - Intronic
921006364 1:211097626-211097648 CTAGACTGTAACCTCCTCAAAGG + Intronic
921047491 1:211487879-211487901 CTTGAGTGTACACTCCTTGAGGG - Intronic
921715815 1:218416329-218416351 CTATCCTGTAACCTCCTTTAGGG + Intronic
921721411 1:218475935-218475957 CTAGATTATAAACTCCTTGAAGG + Intergenic
921995642 1:221414972-221414994 CTAGAGTTTAAACTCCACAAGGG + Intergenic
922248092 1:223819904-223819926 CTAGAATGTAAACTATTTAAGGG - Intronic
922327297 1:224539911-224539933 CCAGATTGTAAGCTCCTTGAGGG + Intronic
922732232 1:227955060-227955082 CATGAGTGTATCCTCCTTGATGG + Intergenic
923343308 1:233025883-233025905 CTAGATTGTGAGCTCCCTAAGGG + Intronic
923543965 1:234910552-234910574 CTGGATTGTAAGTTCCTTAAGGG + Intergenic
923745154 1:236693377-236693399 CTTGGCTGTAAGCTCCTTAAGGG - Intronic
924371180 1:243351379-243351401 CTAGAATATAAACTCCCTAAGGG - Intronic
924498247 1:244611155-244611177 CTAGAATGTAAGCTCCATGAGGG + Intronic
924524939 1:244837678-244837700 GTAGAATGTCAGCTCCTTAAAGG - Intronic
924732219 1:246722765-246722787 CTAGAATGTAAACTTCTTGAGGG + Intergenic
1063238820 10:4147004-4147026 CTAGAGTGGAAGCTCCATGAAGG + Intergenic
1063635767 10:7781069-7781091 CTAGATTGTAACCTCCTTGAAGG - Intronic
1063823143 10:9860974-9860996 CTAGAATGTAACCTCCATGAGGG - Intergenic
1063996751 10:11626928-11626950 CTAGAATGTAAACCCCTTGAAGG + Intergenic
1064228550 10:13508792-13508814 CTAGGCTGTAAACTCCTGAAGGG - Intronic
1064618342 10:17187588-17187610 CTAGAATGTAAGCTCCTTGAGGG - Intronic
1064621693 10:17224106-17224128 CTGGAATGTAATCTCCCTAAGGG - Intergenic
1065152097 10:22832346-22832368 CTAGTCTGTAAGCTCCTTAAAGG - Intergenic
1065229550 10:23583304-23583326 CTAGAATGTAAGCTTCTCAAAGG + Intergenic
1065240689 10:23700890-23700912 CTAGAAGGTAAACTCCATAAAGG + Intronic
1065395788 10:25236094-25236116 CTAGACTGTAAGCTCCATGAGGG + Intronic
1065794624 10:29294518-29294540 CTAGAGTGTAAGTCCCTTGAGGG + Intronic
1065849810 10:29778394-29778416 CTAGAGTGTAAGCTCTTTGAGGG + Intergenic
1066209301 10:33221334-33221356 CTAGACTGTAAGCTCCATGAAGG - Intronic
1067035063 10:42909007-42909029 TTAGAATGTAAACTCCATAAGGG - Intergenic
1068597731 10:58921426-58921448 CCAGAGTGTAAACTCCATATGGG + Intergenic
1068791009 10:61031027-61031049 CTAGACTGTAAACTCCTCGAGGG + Intergenic
1068877296 10:62010404-62010426 CTAGACTCTAAGCTCCTTGAGGG + Intronic
1068936129 10:62637358-62637380 CTAGACTGAAAACTCCTTCAGGG + Intronic
1068937263 10:62648092-62648114 CTAGAATGTTAGCTCCTTGAGGG + Intronic
1070092407 10:73300964-73300986 CTAGAATGTAAGCTCCATGAGGG - Intronic
1070160561 10:73864393-73864415 CTAGAGTGTCAGCTCCATGAGGG - Intronic
1070498675 10:77049516-77049538 ATCGACTGTAAGCTCCTTAAAGG + Intronic
1070567412 10:77614395-77614417 CTAGATTGTAAGCTCCTAACTGG - Intronic
1071703628 10:87972026-87972048 CTGGAGTGTAAACTCTTCAAGGG - Intergenic
1071703679 10:87972688-87972710 CTAGAATGTAAGCTCCATGAAGG - Intergenic
1071712343 10:88061881-88061903 CTAGATTGTAATCTCCTTGAGGG - Intergenic
1071848474 10:89543938-89543960 CTAGAGTGTAAGCTATTTGACGG + Intronic
1071866221 10:89735374-89735396 CTAGATTTTAAGCTCCTTGATGG - Intronic
1072077190 10:91989083-91989105 ATAGACTGTAAGCTCCTAAAGGG - Intronic
1072317577 10:94217862-94217884 CTAAATTGTCACCTCCTTGAGGG - Intronic
1072434109 10:95399971-95399993 CTAGACTGTAAGCTCCCTGAAGG - Intronic
1072720869 10:97780362-97780384 CTAGACTGTGAGCTCCCTAAAGG - Intergenic
1072825357 10:98600174-98600196 CTAGAATATAAGCTCCTTGAGGG - Intronic
1073366036 10:102941813-102941835 CTAGAACGTAAGCTCCATAAGGG + Intronic
1073654028 10:105393057-105393079 CTAGAATGCAAGCTCCCTAAGGG + Intergenic
1074118360 10:110474764-110474786 ATAGAATATAAGCTCCTTAAGGG - Intergenic
1074300108 10:112225801-112225823 CTAGGGTGTCAGCTTCTTAATGG + Intergenic
1074444179 10:113504813-113504835 CTAGATTGTAAGCTTCTTAAGGG - Intergenic
1074469472 10:113714380-113714402 CTAGAGTGTAAACTCTATGAGGG - Intronic
1074544419 10:114391596-114391618 GTAGGCTGTAAGCTCCTTAAGGG - Intronic
1074567573 10:114594905-114594927 CTAGAGAGTAAGCTCTTTGAGGG - Intronic
1074918621 10:117983686-117983708 CTAGACTTTAAGCTCCTTAAGGG + Intergenic
1074923375 10:118042605-118042627 CTAGAGTATAAGCTCCTGGAAGG + Intronic
1075183249 10:120231514-120231536 ATAGAATGTAAGCTCCTGAAGGG - Intergenic
1075481584 10:122787008-122787030 CTAGAGTATAAACTCCATGAGGG - Intergenic
1075658633 10:124177875-124177897 CTAGAGTATACCCTCCTGGAAGG + Intergenic
1078132854 11:8627143-8627165 CTAAAGTGTAAACTCCATTAGGG + Intronic
1078920873 11:15829242-15829264 CTAGAGTTTAAACTCCATACAGG + Intergenic
1078968168 11:16371505-16371527 CTAGAACGTAAGCTCCTTGAGGG + Intronic
1078997072 11:16712799-16712821 CTAGAATATAAGCTCCATAAAGG + Intronic
1079000261 11:16747943-16747965 CTAGAATGTAAGGTCCTTAAAGG + Intronic
1079008000 11:16806027-16806049 CTAGAGAGTAACCTAATTAGGGG + Intronic
1079041361 11:17063362-17063384 CTAGAATGTAAGCTCCTTGCAGG - Intergenic
1079515195 11:21259214-21259236 CTAGATTATAACATCCTCAAGGG - Intronic
1079605385 11:22359065-22359087 CTACAATGTAAACTGCTTAAGGG - Intronic
1079736860 11:24008250-24008272 CTAGACTGAAACCTACTTGACGG - Intergenic
1079934384 11:26599387-26599409 CTAGAATATAACTTCCTTAAAGG + Intronic
1080046759 11:27816963-27816985 CTAAAATGTAAGCTCCTTGAGGG - Intergenic
1080074023 11:28126761-28126783 CTAAATTGTAAGCTCCTTAAGGG - Intronic
1080110471 11:28561357-28561379 CTAGATTTTAAGATCCTTAAGGG + Intergenic
1080200070 11:29658588-29658610 CTAGATTTTAAGCTCCTTAAGGG - Intergenic
1080248090 11:30202177-30202199 CTAGAATGTAATCTCCATGAGGG - Intergenic
1080340001 11:31251142-31251164 CTAGAGTGTAAACTACATGAAGG - Intronic
1080765959 11:35296928-35296950 CTAGAATGTAAGCTCCACAAGGG + Intronic
1080817131 11:35769429-35769451 CTAGACTGTGACCTCCCTCAGGG - Intronic
1080837234 11:35950604-35950626 CTAGATTGAAAGCTCCTTGAGGG + Intronic
1081605631 11:44525641-44525663 CTAGATTGTAAGCTCCTTGAAGG + Intergenic
1081869767 11:46377998-46378020 CTAGAATGTAAGCTCCATGAGGG + Intronic
1081925007 11:46819027-46819049 CTGGAGTGTAAGCTCCACAAGGG - Intronic
1082874149 11:57971008-57971030 CAAGAATGTAAGCTCCTTGAGGG + Intergenic
1083134884 11:60663018-60663040 TTAGAATGTAAGCTCCCTAAGGG - Intergenic
1083796180 11:65018087-65018109 CTAGAGTGTAAGCTTCCTAAGGG + Intronic
1085062229 11:73458143-73458165 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1085089436 11:73697721-73697743 CCAGAATGTAAGCTCCATAATGG + Intronic
1085780304 11:79402082-79402104 CTAGATTGTAAGCTCCTTGAGGG + Intronic
1085976978 11:81668041-81668063 CTAGAATGTAAGCTTCTTGAGGG + Intergenic
1086219003 11:84418999-84419021 TTAAAATGTAAACTCCTTAAGGG + Intronic
1086324809 11:85687390-85687412 TTAGACTGTAAGATCCTTAAGGG + Intergenic
1086841811 11:91694936-91694958 CTAGACTGTGAGTTCCTTAAAGG - Intergenic
1087108307 11:94434157-94434179 CTAAAGTGTAAATTCCTTGAAGG + Intronic
1087144342 11:94797486-94797508 CAAGAGTCTAAACTCCTCAAAGG - Intronic
1087256065 11:95955542-95955564 CTAGTATGTAAACTCCATAAAGG + Intergenic
1087287268 11:96278426-96278448 CTACATTGTAAGCTTCTTAAGGG - Intronic
1087801356 11:102507972-102507994 CTAGATTGTCAGCTTCTTAATGG - Intergenic
1087929552 11:103961082-103961104 TTAGGGTGTAAGCTCCTTAAGGG + Intronic
1088086074 11:105981973-105981995 CTAGACTGTAAGCTCCTTGAGGG + Exonic
1088215510 11:107503993-107504015 CTAGAATGTAAGCACCATAAGGG + Exonic
1088456687 11:110040226-110040248 CTAGAGTGTAAGCTCCACATGGG + Intergenic
1088474259 11:110218974-110218996 CTAGAATGTAAGCTCCATGAGGG - Intronic
1088510333 11:110566940-110566962 CTAGAGTGCAAACTCCATGAAGG + Intergenic
1088654394 11:111985575-111985597 CTTGAATGTAAACTCCATAAGGG - Intronic
1088737311 11:112738263-112738285 CTAGATTGTAAACTCCATAAAGG + Intergenic
1089006891 11:115099495-115099517 CTGGACTGTAAGCTCCTTGAGGG + Intergenic
1089094214 11:115905087-115905109 CTAGAATATAAACTCCATAAGGG + Intergenic
1089127276 11:116185524-116185546 CTAGATTGTAAGCTTCATAAGGG - Intergenic
1089276779 11:117342132-117342154 CTAGAATGTAAGCTCCATAATGG + Intronic
1089430037 11:118415662-118415684 CTAAACTGTAAGCTTCTTAAGGG + Intronic
1089568124 11:119383191-119383213 CTAGAATGTAAGCTCCCTGAGGG - Intergenic
1089742645 11:120595418-120595440 CTAGACTGTAAGTTCCATAAAGG + Intronic
1089784826 11:120900489-120900511 CTGGAATGTAAGCTCCTTACAGG - Intronic
1090011130 11:123046868-123046890 CTAAAGTGTAAGCTCCTTGGGGG + Intergenic
1090067393 11:123514864-123514886 CTAGACTGTGAGCTCCTTGAGGG + Intergenic
1090339170 11:126000517-126000539 CTATATTGTAAACTTCTTAAAGG + Intronic
1091109688 11:132954246-132954268 CTAGACTATAAACTCCTTGAGGG - Intronic
1091515684 12:1178847-1178869 CTAGAATGTAAGCTCCATGAAGG + Intronic
1091523892 12:1276654-1276676 CTAGAATGAAAGCTCCTTGAGGG + Intronic
1091756542 12:3056097-3056119 GTAGAATATAAGCTCCTTAAGGG - Intergenic
1091853328 12:3718777-3718799 CTGGAGTGTAAGCTCCATGAAGG + Intronic
1092077072 12:5682804-5682826 CTAGATGGTTAGCTCCTTAAAGG - Intronic
1092092540 12:5814618-5814640 CTAGAAAGTAAGCCCCTTAAGGG + Intronic
1092574287 12:9762523-9762545 CTAGACTGTAAGCTGCTTGAGGG + Intergenic
1092748604 12:11696881-11696903 CTAGAATGCAAACTCCTTGAGGG + Intronic
1092802493 12:12184333-12184355 CTAAATTGTAACCTCTTTTAGGG - Intronic
1093044837 12:14431238-14431260 CTAGACAGTAAGCTCATTAAGGG - Intronic
1093156750 12:15695641-15695663 CTAGATTGTAAGCTCCATGAAGG - Intronic
1093478992 12:19585178-19585200 CTAGTCTGTGAGCTCCTTAAGGG + Intronic
1093507958 12:19891453-19891475 CTAGACAGTGAGCTCCTTAAGGG + Intergenic
1093616711 12:21233924-21233946 CTAGTGTGTAACCACCTAACGGG + Intronic
1093975178 12:25413649-25413671 TTAGAATGTAAGCTCCATAAGGG - Intronic
1094256238 12:28430402-28430424 CCAGAGTGTGAACTCCTTTAGGG - Intronic
1094554917 12:31489383-31489405 CTAGACTGTGAACTCCCTAAAGG - Intronic
1095260458 12:40093466-40093488 CTAGAGTGTAATCTCCATGAAGG - Intronic
1095436962 12:42200137-42200159 CCAGAGTGTAAACTCTGTAATGG - Intronic
1095482783 12:42652915-42652937 CTAGAATGTAAGCGCCTTAAAGG + Intergenic
1095567726 12:43646147-43646169 CTAGAATGTAAGCTCCTGGAGGG + Intergenic
1096008643 12:48193813-48193835 TTAGACTGTGAGCTCCTTAAAGG - Intergenic
1096104378 12:48987935-48987957 CTAGATTGTGAACTCCTTGAGGG + Intergenic
1096342304 12:50811352-50811374 CTAGAATATAAGATCCTTAAGGG + Intronic
1096488514 12:52000423-52000445 CTAGATTATAAACTCCTTGAAGG - Intergenic
1096600918 12:52728490-52728512 CTAGACTGTAAGTTCCTTAAGGG + Intergenic
1096753867 12:53782634-53782656 TTAGAATATAAGCTCCTTAAGGG - Intergenic
1097026114 12:56056866-56056888 CTAGAATGTAAGCCCCTTGAAGG + Intergenic
1097080284 12:56425314-56425336 CTAGAGTAAAAGCTCCTCAAAGG - Intronic
1097266806 12:57750751-57750773 CCAGAGTGTAACAACCTAAAGGG + Exonic
1097282228 12:57852200-57852222 CTGCAGTGTAAGCTCCTTCAGGG + Intergenic
1097344751 12:58478333-58478355 TTAGAGTGTAAGCTCTTCAAGGG - Intergenic
1097988688 12:65811356-65811378 CTAGAGCCTAACCTACTTGAAGG + Intergenic
1098005635 12:65994007-65994029 CTAGAGTGCCTCCTCTTTAAGGG + Intergenic
1098524682 12:71473120-71473142 CTAGATTGTAATCTCTTTGAGGG - Intronic
1098538852 12:71628577-71628599 CTAGCCTGTGTCCTCCTTAAGGG - Intronic
1098824399 12:75275208-75275230 CTAGACTGTAAACTTCTTGAAGG - Intergenic
1099097570 12:78394267-78394289 CTAGAATGTAAACTCATTGAAGG - Intergenic
1099113510 12:78593222-78593244 CTAGAATGTAAGCTCCCTCAGGG + Intergenic
1099143346 12:79007990-79008012 CTAGAGTATAAGTTCCTTGAGGG - Intronic
1099223436 12:79940754-79940776 CTAGAATGTAAGCTCATTGATGG - Intergenic
1099255728 12:80309211-80309233 CTAGACTCTAAATTCCTTAAAGG - Intronic
1099372624 12:81855975-81855997 CTAAAGTGCAAACTCCTTGAAGG - Intergenic
1099477434 12:83123984-83124006 CTGGACTGTAAACTCCTTAAGGG + Intronic
1099837547 12:87926117-87926139 ATAGATTGTAAGCTTCTTAAAGG - Intergenic
1099936178 12:89128509-89128531 CTAGAATGTGAGCTCCCTAAGGG + Intergenic
1100346250 12:93734246-93734268 CTAAAATGTAAGCTCCTTGAGGG - Intronic
1100409650 12:94302806-94302828 CTAGATTGTAAGCTTCTCAAGGG + Intronic
1100423104 12:94456891-94456913 CTAGATTGTAAGCTTATTAAGGG - Intronic
1100702199 12:97160822-97160844 CTAGAGTGGAAGCTCCCTGAGGG - Intergenic
1100792379 12:98144515-98144537 CTAGACTGTAAGCTCCATGAGGG - Intergenic
1101030470 12:100653361-100653383 TTAGAGTGTAAGCTCCATGAGGG - Intergenic
1101419543 12:104538640-104538662 CCAGATTGTAACCTCCTTCATGG + Intronic
1101477494 12:105064567-105064589 CTAGACTGTGAACTCCTTAGGGG - Intronic
1101770924 12:107750163-107750185 CCAGACTGTAAGCTCCTTAAAGG + Intronic
1101791070 12:107928244-107928266 GCAGAGTGTAAACTCCTTGAGGG + Intergenic
1103006211 12:117422489-117422511 CTAGAGTATAAATTCCTTGAAGG - Intronic
1104524226 12:129502941-129502963 CTAGAATGTAACCTTCATGAGGG + Intronic
1104739172 12:131160187-131160209 CTAGACTGAAATCTCCTTGAAGG + Intergenic
1105072334 12:133242318-133242340 CTAGAGTGGAACCTCGTCATCGG - Intergenic
1105977124 13:25482019-25482041 CTGGAGAGGAACCTCTTTAATGG - Intronic
1105981355 13:25519400-25519422 CTAGAGTGCAATTTCCTTGAGGG + Intronic
1106251313 13:27983723-27983745 CTAGAATGTAAGCTCATTTAAGG + Intronic
1106270027 13:28144138-28144160 CTAGAATGTAAACTCCATTAGGG - Intronic
1106454515 13:29915375-29915397 CTAGAGTGTAAGTTCCTTCTGGG - Intergenic
1106454774 13:29917514-29917536 CCAGATTCTAAGCTCCTTAAGGG + Intergenic
1106570866 13:30926422-30926444 CAAGAGTGGAAGCTCCTTGAAGG - Intergenic
1107585865 13:41847699-41847721 CTAATGGGTAACCTCGTTAATGG + Intronic
1107657776 13:42609648-42609670 CTAGAATGGAAACTCCTCAAGGG - Intergenic
1107861120 13:44661669-44661691 CTAGACTGTGAGCTCCTTGATGG + Intergenic
1108130362 13:47292866-47292888 ATTGAGTTTAACCTCCTTCAGGG + Intergenic
1108261089 13:48657408-48657430 CTTTAGTGTAAAGTCCTTAACGG + Intronic
1108382996 13:49872132-49872154 CTAAACTGTGACCTCCTCAAGGG + Intergenic
1108440694 13:50450033-50450055 CTAGACTGTAAGCTCCACAAGGG + Intronic
1108592013 13:51920777-51920799 CTAGAATGTAAACTCATGAAGGG + Intergenic
1108696128 13:52904164-52904186 CCAGACTGAAAGCTCCTTAAGGG - Intergenic
1109096676 13:58127728-58127750 CCAAAGTGTAACCTCCTAAGAGG + Intergenic
1109249216 13:59998373-59998395 CTTGAGTATAAGCTTCTTAAGGG + Intronic
1110063964 13:71078022-71078044 ATAGACTGTAAACTCCTTGAAGG - Intergenic
1110198617 13:72820981-72821003 CCAGAGTGTAAACATCTTAAGGG - Intronic
1110243872 13:73299579-73299601 CTAGAATGTAAACTCCGTAAGGG + Intergenic
1110831890 13:80041373-80041395 TTAGACTTTAACCTCCCTAAAGG - Intergenic
1111760250 13:92454624-92454646 CTAGAGTGAAAGCTCCTTGAGGG - Intronic
1111825004 13:93256784-93256806 CTACAGAGTAAGCTCCTTGAGGG - Intronic
1111893432 13:94111725-94111747 CTAGATTGTAAACTCCTTGATGG + Intronic
1112128876 13:96499433-96499455 CTAGAATGTAAGCTCCTCCAGGG - Intronic
1112532128 13:100215364-100215386 CTATAGTGTAAGCTCCTTGAGGG - Intronic
1112784021 13:102931724-102931746 CTATAGTGGAACACCCTTAATGG + Intergenic
1113012021 13:105779077-105779099 CTAGAATGTAACCTTCATGAGGG - Intergenic
1114730509 14:24987954-24987976 CTAGAATGTAAGCTCCATGAGGG - Intronic
1115192282 14:30758566-30758588 CTAGAATGCAAACTCCTTGAGGG - Intergenic
1115330506 14:32191846-32191868 CTAGACTATAACCTCCCTAATGG - Intergenic
1115372000 14:32626827-32626849 CTAGATTATAAGCTCCTTGAAGG + Intronic
1115406976 14:33028104-33028126 CTAGAGTGTAACCTACATGATGG - Intronic
1116105676 14:40501263-40501285 CTAGAGTGTAAGCTCCACGAGGG - Intergenic
1116610023 14:47057358-47057380 TTAGATTGTAAGCTCCTTAAGGG + Intronic
1116766997 14:49084783-49084805 CTGGAATGTAACCTCCAGAACGG + Intergenic
1116863341 14:50011898-50011920 TTAGATTGTAAACTCCTTGAGGG - Intergenic
1117127026 14:52640144-52640166 CTAGAATGTGAGCTCCTTAAGGG - Exonic
1117312430 14:54541469-54541491 CTAGAATGTAAGCTCCATGAAGG - Intergenic
1117776821 14:59191338-59191360 CTAGATTATAAGCTCCTTGAGGG + Intronic
1118018352 14:61684725-61684747 ATAGAGTGTGAGCTCCTTATGGG - Intergenic
1118675214 14:68177043-68177065 CTAGAGTGTAACTGCCAGAATGG + Intronic
1118766536 14:68913527-68913549 TTAGAGTATACCATCCTTAATGG - Intronic
1118766822 14:68915476-68915498 CTAGAATGTAAGCCCCTTGAGGG + Intronic
1119101519 14:71884291-71884313 CTGGACTGTCAGCTCCTTAAGGG - Intergenic
1119214564 14:72858628-72858650 CTAGACTGTAAACTCCTGGAGGG - Intronic
1119424062 14:74524553-74524575 CTGGAATGTGCCCTCCTTAAAGG - Intronic
1119752419 14:77089125-77089147 CTGGAGTCTAAACTCCTTAAGGG - Intergenic
1120068633 14:80076963-80076985 CTAGATTGTAAGCTCCATGAAGG + Intergenic
1120937327 14:89910048-89910070 CTAGACTCTAAGCTCCTAAAGGG + Intronic
1120964154 14:90152853-90152875 ATAGAATGAAACCTCCTTGAAGG - Intronic
1121044796 14:90779822-90779844 CTAGAGTGCAAACTGCTTCATGG + Intronic
1121047591 14:90799391-90799413 CTAGAGTGTAAGGTCCTTGAGGG - Intronic
1121343975 14:93121626-93121648 CTAGACTGTAAGCCCCTTGAGGG + Intergenic
1121418999 14:93799203-93799225 CTAGAATGTAAGCTCCATGAGGG + Intergenic
1122256955 14:100485356-100485378 CTAGAATGTAAGCTCTTTGAAGG + Intronic
1124861298 15:33444527-33444549 CTAGTATGTAAACTCCTTGAGGG - Intronic
1125030052 15:35067098-35067120 CTAGAATGTAAGCTCCTTGAGGG + Intergenic
1125150929 15:36531321-36531343 ATAGAATGTAAGCTCCTTAAAGG + Intergenic
1125413707 15:39430833-39430855 CTAGATATTAACCTCCTTGAGGG + Intergenic
1125485768 15:40109690-40109712 GTAGACTGTAAGCTCCTTGAGGG - Intergenic
1125498968 15:40225291-40225313 CTAGAATTTAAACTCCTTAAGGG + Intergenic
1125907115 15:43403140-43403162 CTAGATTGTGAGCTCCTTAAGGG - Exonic
1125990845 15:44106316-44106338 ATAGAGTCTAAACTCCTAAAAGG + Intronic
1126102326 15:45126603-45126625 TTAGACTGTAATCTCCTTGAGGG + Intronic
1126545921 15:49874151-49874173 CTAGAGTGTAACCTTCACGAAGG - Intronic
1126736932 15:51739551-51739573 CTAGATTGTAAACTCTTTGAAGG - Intronic
1127037772 15:54937723-54937745 CCAGAATATAACTTCCTTAAGGG + Intergenic
1127529774 15:59832490-59832512 CTAGATTGTAAGCTCCTAAAGGG + Intergenic
1127610214 15:60629433-60629455 TTAGAGTCTAAGCTCCTTGAGGG + Intronic
1127675582 15:61235082-61235104 CTGGATTGTAAGCTCCTTGAGGG + Intergenic
1128151998 15:65368992-65369014 CTAGATTTTAAGCTCCTAAAGGG - Intronic
1128325446 15:66721048-66721070 CCAGACTGTAAGCTCCTTGAGGG + Intronic
1128414373 15:67430816-67430838 CTAGAATGTGAACTCCCTAAGGG - Intronic
1128447836 15:67780362-67780384 CTAGATTGTAAGTTCCTTGAAGG + Intronic
1128625308 15:69195929-69195951 CTAGAATGTAAGCTCCATAGAGG - Intronic
1129004762 15:72363267-72363289 CTAGACTGTGATCTCCTCAAGGG - Intronic
1129792338 15:78349740-78349762 CCAGAGTGTAAGCTCTTTGAGGG - Intergenic
1130007009 15:80109291-80109313 CTAAAATGTTACCTCCCTAATGG - Intronic
1130346120 15:83047116-83047138 CTAAATTGTAAACTCCTTGAAGG - Intronic
1130548862 15:84876577-84876599 CTAGACTGTAAGCTCCATAAGGG - Intergenic
1131228332 15:90643091-90643113 CTAGACCGTAAGCTCCTTGAGGG + Intronic
1131246179 15:90795717-90795739 CTAGAGTGTAAGCTCCACAAGGG - Intronic
1131288889 15:91087417-91087439 CTAGACTGTAAGCTCCTTGATGG + Intergenic
1133854394 16:9536135-9536157 CTAGACTGGAAGCTCCATAAGGG - Intergenic
1134559610 16:15196937-15196959 CTAGACTGTTAACTCCTTGAAGG - Intergenic
1134887739 16:17808876-17808898 CTAGAGTGTGATCTCTTAAATGG - Intergenic
1134920150 16:18108548-18108570 CTAGACTGTTAACTCCTTGAAGG - Intergenic
1135161216 16:20098207-20098229 GTAGACTGTAATCTCCTTGAAGG - Intergenic
1135499820 16:22985684-22985706 CTAGACTGTGACCCTCTTAAGGG + Intergenic
1135910155 16:26553218-26553240 CCAGAGTGTAAACTCCATGAGGG - Intergenic
1136374654 16:29858452-29858474 CTAGAATGTAAACTCCATGAAGG - Exonic
1136516387 16:30771226-30771248 CTCAAGTGTCACCTCCTAAAAGG - Intronic
1136595761 16:31248820-31248842 CAAGAACGTAAGCTCCTTAAAGG + Intergenic
1137933348 16:52609494-52609516 CTAGAATGTCAGCTCCTTGAGGG - Intergenic
1138982602 16:62288187-62288209 CTATAGGGTAAGCTCCTTGAAGG + Intergenic
1139198007 16:64943854-64943876 CTAGAATGTAAGCTCCATGAGGG - Exonic
1139246152 16:65446398-65446420 CTAGAGTGTAAGCTCCTTGAAGG + Intergenic
1139301150 16:65946502-65946524 CTGGAATGTAAGCTCCATAAAGG - Intergenic
1139309523 16:66016638-66016660 CTAGAATGTAAACTCCATGAGGG + Intergenic
1139692371 16:68649519-68649541 CTAGACTGTAAGCTCCCCAAGGG - Intronic
1140300771 16:73755355-73755377 CTGGAGTTTAAACTCCCTAACGG + Intergenic
1140353584 16:74285579-74285601 CTTCAGTTTAACCTCCTTAAAGG - Intergenic
1140384301 16:74520923-74520945 ATAGAATGTAAACTCCTTGAAGG - Intronic
1140647093 16:77044409-77044431 CTAGACTTTAAGCTCCTTGAGGG - Intergenic
1140726234 16:77815425-77815447 CTAAAGTGCAACCTCCTTGAAGG - Intronic
1140875373 16:79146746-79146768 CTAGAATGTAAGCTCCTTGAAGG - Intronic
1140894775 16:79315193-79315215 CTAGAATGTAAACTCCACAAGGG - Intergenic
1141067993 16:80929409-80929431 CTAGACTATAACCTCCATGAGGG - Intergenic
1141926127 16:87170810-87170832 CTAGAATGTAACCTCCATGGAGG + Intronic
1142060509 16:88026302-88026324 CTAGAGTACAAACTCCTTACGGG - Intronic
1143244465 17:5471351-5471373 TGAGAATGTAAGCTCCTTAAGGG - Exonic
1143444829 17:7001486-7001508 CTAGACTATAACCTCCTAGAAGG + Intronic
1143874369 17:9980718-9980740 CTAGACTGTAAGCTCCCTGAGGG - Intronic
1143992530 17:10978603-10978625 CTATATTGTAAGCTCCTCAAGGG - Intergenic
1144040533 17:11406599-11406621 CTAGACTGTGAGCTCCTTACTGG + Intronic
1144554851 17:16273129-16273151 CTAGACTGCAAGCTCCTTGAGGG - Intronic
1145965647 17:28914967-28914989 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1145974913 17:28978370-28978392 CTAGACTGTGAGCTCCTTAAGGG - Intronic
1146055741 17:29580132-29580154 CTAGATTGTGAGCTCCTTAAGGG + Intronic
1146083174 17:29801680-29801702 TCAGATTGTAATCTCCTTAAGGG + Intronic
1146242887 17:31246566-31246588 CTAAACTGTAAGCTCCTTGAAGG - Intronic
1146927310 17:36753923-36753945 CTAGAGTGTAAACCCCCTGAGGG - Intergenic
1147487032 17:40826081-40826103 GTAGATTGTAAACTCCTTGAAGG - Intronic
1147691594 17:42318896-42318918 CTAGGGTGTCAGCTCCCTAAGGG - Intronic
1148117454 17:45184966-45184988 AGAGAGTGTAAGCTCCATAAGGG - Intergenic
1148429515 17:47631051-47631073 CTAGATTGTAAGCTCCATTAGGG - Intergenic
1148529423 17:48375005-48375027 CTAGATTGTAAGCTCCTTGTAGG - Intronic
1148679214 17:49463891-49463913 CTAGACTGGAAGCTCCTTGAAGG + Intronic
1148909900 17:50935976-50935998 CTAGAATATAAGCTTCTTAAAGG - Intergenic
1149007879 17:51824322-51824344 CTAGAGTGTAAACTACCTGAAGG - Intronic
1149011872 17:51865274-51865296 CTAGAATGTAAGCTCCATGAAGG + Intronic
1149395987 17:56244275-56244297 CTGGAATATAAGCTCCTTAAGGG - Intronic
1149600811 17:57891928-57891950 CTAGAATGTAAGCTCCATGAAGG + Intronic
1149681386 17:58509787-58509809 CTAGAGTTTAGCCTCCTTGAAGG + Intronic
1150493345 17:65589236-65589258 CTACAGTGTGAGCTCTTTAAGGG + Intronic
1150807157 17:68328569-68328591 CTAGAGTATAAACTCGTTGATGG + Intronic
1150826645 17:68481977-68481999 CTGGATTATAAACTCCTTAAAGG - Intergenic
1150914892 17:69426518-69426540 CTAGACAATAACCTCCTTAAGGG - Intronic
1150949405 17:69785280-69785302 ATAGAATGTAAGCTCCATAATGG + Intergenic
1151395798 17:73822090-73822112 TTAGATTGTCACCTCCTCAAGGG + Intergenic
1151549669 17:74814825-74814847 GCAGAGTGTAACCCCCTTGAGGG - Intronic
1151602037 17:75111945-75111967 CTAGAATGTAAGCTCCTGAGGGG - Intronic
1152005828 17:77680052-77680074 CTGGAGTGTCACTTCCTCAAGGG - Intergenic
1152050994 17:77977147-77977169 CTAGATTATAAACTCCTTGAAGG + Intergenic
1153030381 18:708352-708374 CTCAAATGTAACCTCCTCAAGGG - Intronic
1153332053 18:3883508-3883530 CTAAATTGTGACGTCCTTAAGGG + Intronic
1153334818 18:3912512-3912534 CTAGACTGTAAGCTCCCTGAGGG - Intronic
1153423882 18:4941482-4941504 CTAGAATGTAAGCTCCATGAAGG + Intergenic
1153688804 18:7570392-7570414 CTAGATTGTAAGCTCCCTGAGGG + Intronic
1154228257 18:12528261-12528283 CTAGACTGTGAACTTCTTAAGGG - Intronic
1154409108 18:14126577-14126599 CTAGATTGCAAGCTCCTTCATGG + Intronic
1156283295 18:35663294-35663316 CTAGAGTCCAACCTCTGTAATGG - Intronic
1156897347 18:42261224-42261246 CTAGATTGTAAGTTCCTCAAGGG + Intergenic
1157027707 18:43866300-43866322 CTAGAGTAAAACCTTCTTGAGGG - Intergenic
1157082710 18:44545302-44545324 CCAGAATGGAAACTCCTTAAGGG - Intergenic
1157188695 18:45562196-45562218 CTAGACTGTAAGCTCCTTAAAGG - Intronic
1157343717 18:46804204-46804226 CTAGATTGTAAGCTCCATGAGGG - Intergenic
1157434656 18:47658190-47658212 CCAGACTGTAAGCTCCTTGAGGG + Intergenic
1157479748 18:48045775-48045797 CTAGATTGTAAGCTGCTTGAGGG + Intronic
1157584418 18:48792013-48792035 CTAGAATGTAAGCTCCATGAGGG - Intronic
1157640767 18:49211720-49211742 CTAGGTTGTAAGCTCCCTAAGGG - Intronic
1157703427 18:49780200-49780222 TTAGACTGTAAACTCCATAAAGG - Intergenic
1157848160 18:51023467-51023489 CTAGAATGTAAGCTCCATGAGGG - Intronic
1157879104 18:51303194-51303216 CTAGAATGTAAGCTCCATGAAGG - Intergenic
1158000808 18:52616660-52616682 CTAGATTATAAACTCCTTCAGGG - Intronic
1158849772 18:61483646-61483668 CTAAACTGTAAACTCCTTGAAGG + Intronic
1158852381 18:61508324-61508346 CTAGAATGTAAACTCCATGAGGG - Intronic
1158989700 18:62855981-62856003 CTAGATTGTAAGCTCCATAAAGG - Intronic
1159965238 18:74588570-74588592 CTAGACTGTAACATCTTTACAGG + Intergenic
1160135852 18:76271150-76271172 CTAGACTGTAAGCTCCTTGAGGG + Intergenic
1160313414 18:77819002-77819024 CTAGAATGTGAAATCCTTAAAGG - Intergenic
1162351297 19:10151335-10151357 CTAGAGGGCAACCTGCTTATTGG + Intronic
1163157491 19:15447465-15447487 CTAGAGTGTCAGCCCCTTGAGGG + Intronic
1165408780 19:35645714-35645736 CTGGACTGTGAGCTCCTTAAGGG - Intergenic
1165464492 19:35965207-35965229 CTAGAGTGTCAGCTCCCTGAGGG - Intergenic
1165909919 19:39219290-39219312 CTGGAGTGTAATCTCCACAAGGG - Intergenic
1166289231 19:41851064-41851086 CTAGAACGTAAGCTCCTTGAAGG - Intronic
1166392703 19:42418862-42418884 CTAGATTGTAAACTCCCTGAGGG + Intronic
1166400159 19:42472778-42472800 CTAGACTGCAACCTCCTTAAAGG - Intergenic
1166929227 19:46291380-46291402 CTAGAGTGTAAGTTCCATGAGGG + Intergenic
1167011156 19:46809036-46809058 CTAGAATGTCACCTCCACAAGGG + Intergenic
925666199 2:6258886-6258908 CTAGAGTGGAAGCTCCTGGAGGG + Intergenic
925738419 2:6984201-6984223 CTAGAGTGTAAGTTTCTCAAGGG + Intronic
926872193 2:17433723-17433745 CTAGAATGTAAGCTCCATGATGG - Intergenic
927369230 2:22335481-22335503 CTAGAATGTAAGCTCCCTGAAGG - Intergenic
927475256 2:23409742-23409764 CTAGACTGTAAACTCCTTGAGGG - Intronic
928098692 2:28422287-28422309 CCAGATTGCAACCTCCTTGAGGG - Intergenic
928189723 2:29152505-29152527 CTAGATTGTAAGCTCTTTGAGGG + Intronic
928320197 2:30277221-30277243 CTAGAATGTAAGCTCCACAAAGG - Intronic
928861591 2:35863824-35863846 TTAGATTATAACCTACTTAAAGG + Intergenic
928895490 2:36257651-36257673 CTACAGTGTAAGCTCCATGAAGG + Intergenic
929119428 2:38472101-38472123 TTAGAGTATAAGCTCCCTAAGGG - Intergenic
929210476 2:39351482-39351504 TTAGATTATAAGCTCCTTAAAGG + Intronic
929483733 2:42336956-42336978 CTAGAGTGTATGCTCCGTGAGGG - Intronic
929656725 2:43740008-43740030 CTAGACTGTAGGTTCCTTAAGGG + Intronic
930671936 2:54160480-54160502 CAAGACTGTAAGCTCCTTAAAGG + Intronic
931121390 2:59224278-59224300 ATAAATTGTAATCTCCTTAAGGG + Intergenic
931166031 2:59749414-59749436 CTACAGTCTAAGATCCTTAAAGG - Intergenic
931183523 2:59927570-59927592 CTAGATTATAAGCTCCTTGAGGG - Intergenic
931455554 2:62407360-62407382 CTAGATTTTAACCTCCTTGAGGG - Intergenic
931676026 2:64697087-64697109 CTGGGTTGTAACCTCCTTGAGGG - Intronic
932344386 2:70986030-70986052 GTAGACTGTAAGCTCCTTGAGGG - Exonic
933058997 2:77711748-77711770 CTAAAATGTTACCTCCTCAATGG + Intergenic
933453999 2:82498238-82498260 CTAGAGTGTAAATTCCCCAAGGG + Intergenic
933497811 2:83072736-83072758 CTAGAATGTAAGTTCCTTTAGGG + Intergenic
933607326 2:84397082-84397104 CTAGACTGTGAACTTCTTAAAGG - Intergenic
933878733 2:86646496-86646518 CTGGAATGTAAACTCCTAAAGGG + Intronic
933904010 2:86871509-86871531 GTGGATTGTAACCTCCTGAAGGG - Intergenic
934967768 2:98737854-98737876 CCAGACTGTAAACTCCTTGAAGG - Intergenic
935716189 2:105940889-105940911 CTAGACTGTAAGCTCCTTGAAGG - Intergenic
935776497 2:106477469-106477491 GTGGATTGTAACCTCCTGAAGGG + Intergenic
935796242 2:106644298-106644320 CTAGAATGCAACCTCCGTGAGGG - Intergenic
935953794 2:108354583-108354605 CCAGAGTTTGAGCTCCTTAAGGG - Intergenic
936368224 2:111880625-111880647 GTGGATTGTAACCTCCTGAAGGG + Exonic
936466272 2:112753974-112753996 CTAGAGTGTAAGCTCTATGAAGG + Intronic
936978238 2:118240311-118240333 CTTAAGTGTGACCTCCTTCAGGG - Intergenic
937282746 2:120731493-120731515 TGAGAGTGTAGGCTCCTTAAGGG + Intergenic
938219932 2:129557247-129557269 CTAGACTGTGCCCTCCTTGAAGG - Intergenic
939920123 2:148099966-148099988 CTAGGCTGTAAGCTCCTTGAGGG - Intronic
940193668 2:151069398-151069420 TTAGAATGTAAACTCCATAAGGG - Intergenic
940524829 2:154799857-154799879 CTAGAATGTAAGCTTCTTGAGGG - Intronic
940633216 2:156264431-156264453 TTAGAATGTAAACTCCATAAGGG + Intergenic
940842436 2:158599386-158599408 CTAGTGTGTAACCTCCATGAGGG - Intronic
941179816 2:162245747-162245769 CTAGAATGTAAGTTCCTTAAGGG - Intergenic
941647814 2:168059895-168059917 CTAGAATGTAAGCTCCTTTAGGG + Intronic
941739289 2:169015800-169015822 CTAAAATGTAAACTCCTCAAGGG + Intronic
942244641 2:173996039-173996061 CTAGAAGGTAACCTCCGCAAAGG - Intergenic
943272628 2:185826643-185826665 CTAGAATGTAAGCTTCATAAAGG + Intronic
943469930 2:188281954-188281976 CTGGACTGTGAGCTCCTTAAGGG + Intergenic
943559438 2:189443109-189443131 CTAGACTGTAAGCTCCTCGAAGG - Intronic
943735493 2:191349129-191349151 CTAGACAGTAAGCTCCTTGAAGG + Intronic
943761068 2:191609999-191610021 CTTCAGTGTAACTTCCTTAGAGG - Intergenic
943971668 2:194416377-194416399 CTAGAGAGTAGCCTACTTATTGG + Intergenic
944064788 2:195608078-195608100 ATAGATGGTAACCTCCTTGAGGG - Intronic
944134712 2:196386169-196386191 CTAGAATGTAAGCTCCATGAGGG - Intronic
944202244 2:197120189-197120211 CTACACTGTAAGTTCCTTAAAGG + Intronic
944852782 2:203736816-203736838 CTATAGTATAATCTCCATAAGGG + Exonic
944930659 2:204515869-204515891 CTATACTGTAATCTCCTTGAGGG + Intergenic
945169127 2:206977788-206977810 CTAGACTCTAAGATCCTTAAGGG - Intergenic
945232735 2:207609522-207609544 GTAGAGTGTAAGCTCCTTGAGGG - Exonic
945561327 2:211344289-211344311 CTGTAGAGCAACCTCCTTAATGG - Intergenic
945727341 2:213488088-213488110 TTAGAATGTAAGCTCCATAAGGG + Intronic
946363189 2:219231786-219231808 TTAGAGTGTAAATTCCTTGAAGG + Intronic
946677132 2:222171998-222172020 CTAGAATTTAAGCTCCTTGAGGG + Intergenic
946769439 2:223073717-223073739 CTAGAGTGTAAATTCCTAGATGG + Intronic
946786655 2:223252419-223252441 CTAGATTGTAAACTCATTGAGGG + Intergenic
946821162 2:223630904-223630926 CTAGAATGTAACCCCCATAAAGG + Intergenic
947428646 2:230006617-230006639 CAAGAATGTAAGCTCCTTAAAGG - Intronic
947655008 2:231819521-231819543 CTAGAGTGTGAGCTCCCTCAGGG + Intergenic
948365135 2:237449906-237449928 CTAGAGTGGAACCTCCCTGAGGG - Intergenic
1169006525 20:2211952-2211974 CTAGAATGTAAGCTCTTTGATGG - Intergenic
1169472222 20:5896515-5896537 CTAGAGTCTAAGCTCCATGAGGG - Intergenic
1170052964 20:12166881-12166903 CTAGACTGTGATCTCCTTAAAGG - Intergenic
1170372671 20:15666733-15666755 CTAGACTGTAATCTTCTTGAGGG - Intronic
1170778972 20:19406545-19406567 CTAGACTGTAAATTCCTTTAAGG - Intronic
1170967116 20:21083533-21083555 CTAGAATGTAAACTCCAGAAGGG - Intergenic
1171955531 20:31459986-31460008 CTAGAATGTAAGCTCCATACAGG + Intergenic
1172301873 20:33856113-33856135 TTAGACTGTAACCACCTTGAGGG - Intergenic
1172788269 20:37484829-37484851 ATAGACTGTAAGCTCCTTGAAGG - Intergenic
1173088170 20:39944733-39944755 CTAGACTGCAACCTCTGTAAGGG + Intergenic
1173280184 20:41620132-41620154 CTGGATTGTAAGCTCCTTGAGGG - Intergenic
1173697007 20:45026209-45026231 CTAGAATGAAACCTCCATGAGGG - Intronic
1173913996 20:46693101-46693123 CTAGAATGTAAACTCCATGAGGG - Intergenic
1173934429 20:46848719-46848741 TTAGATTGTAATCTCCTTGAAGG - Intergenic
1173984222 20:47248641-47248663 CTAGACTGGAAGCTCCTTGAGGG - Intronic
1174210230 20:48872366-48872388 CTAGATTGTACACTCCTTGAAGG + Intergenic
1174273154 20:49384216-49384238 CTAAAGTGTCACCTCCATGAGGG + Intronic
1174655756 20:52170834-52170856 CTAGAGTGTCAGCTCCATGAGGG - Intronic
1174757339 20:53173130-53173152 CTAGACTGTAAGCTTCTTGAAGG - Intronic
1174919451 20:54686119-54686141 CTAGAATTTAACCTCATTGAAGG + Intergenic
1175112017 20:56655091-56655113 CTAGAGTGTAAGCTCCATGTGGG + Intergenic
1175353920 20:58346901-58346923 TTAGACTGTAAGCTCCTTGAGGG + Intronic
1175557520 20:59879116-59879138 CTAGACTGTAAGCTCCCTGAGGG + Intronic
1176967055 21:15223232-15223254 CTAAACTCTAACCTCCTTTAGGG - Intergenic
1177073356 21:16540380-16540402 CTAGACTGTAAGCCCCTTGAGGG + Intergenic
1177463305 21:21441524-21441546 TTAGAATCTAAGCTCCTTAAGGG - Intronic
1177571963 21:22898721-22898743 CTAAAATGTAACCTTCCTAAGGG - Intergenic
1177627686 21:23684938-23684960 CTAGATTGAAAGCTCCTTAAGGG + Intergenic
1178027107 21:28480438-28480460 CTAGAGTATAAACCCCTCAAGGG + Intergenic
1178098684 21:29242524-29242546 CCAGAGTGTAAGCTCCCTAAAGG - Intronic
1178526002 21:33329810-33329832 CTAGATTGCAAGTTCCTTAAGGG - Intronic
1179049735 21:37878951-37878973 CTAGACTGTGACCTTCTTGAGGG + Intronic
1181897121 22:26120243-26120265 CTAGACTGTAAGTTCCTTGAGGG + Intergenic
1182120086 22:27780769-27780791 CTAGAATGTAAACTCCATGAAGG + Intronic
1182157993 22:28093900-28093922 CTGGAGTGTAAGCCCCTTAGTGG - Intronic
1182239131 22:28900769-28900791 TTAGATTGTAACCTCCTTCCGGG + Intronic
1182343097 22:29640334-29640356 TTAGATTGTAAGCCCCTTAAAGG + Intronic
1182374638 22:29837790-29837812 CTAGACTGTAAGCTCCATGAGGG + Intronic
1182689117 22:32144135-32144157 CCAGATTTTAACCTCCTGAATGG - Intergenic
1182750739 22:32640272-32640294 CTAGATTGTAAGCTCCTTGGAGG + Intronic
1182895045 22:33852452-33852474 CTGGAATGTAACCTAATTAAGGG - Intronic
1182896655 22:33864550-33864572 CAAGACTGTAAGCTCCTTGAGGG + Intronic
1182996324 22:34816255-34816277 CTAGAATGTAAGCTCCTTGAGGG - Intergenic
1183129418 22:35819724-35819746 CTAGAATGTAAACTCCATAAGGG - Intronic
1183592685 22:38789624-38789646 TTAGATTGTAAGCTCCTTAAAGG - Intronic
1183775034 22:39958437-39958459 CTAGAATGTAAGCTCCCTGAGGG + Intronic
1183876534 22:40786990-40787012 CTAGACAGTAAGCTCCTTAAAGG - Intronic
1184074004 22:42164627-42164649 CTAGACTGTAAGCTCCATTAGGG - Intronic
1184080687 22:42217503-42217525 CTAAAATGTAAACTCCTTAAAGG + Intronic
1184522486 22:45003285-45003307 CTAGACTGTAAGCTCCCTGAGGG - Intronic
1184522497 22:45003393-45003415 CTAGACTGTAAGCTCCCTGAGGG - Intronic
1185129328 22:49028706-49028728 CTAGAATGTAAGCTCCCTGAGGG + Intergenic
949343915 3:3058975-3058997 CTAGATTGTAAGCTCCTTGAGGG + Intergenic
949373321 3:3359268-3359290 CTAGAGTATATCCTAATTAACGG + Intergenic
949862516 3:8519124-8519146 CTAGACTGTAAGCTCCATGAGGG - Intronic
950179827 3:10903502-10903524 CTAAAGTGTAAGCTCCTTAAGGG + Intronic
950325195 3:12101723-12101745 CTATAGTCTAACATGCTTAAGGG - Intronic
950370021 3:12521286-12521308 CTAGAATGTAAACTCCATGAAGG - Intronic
950471161 3:13187219-13187241 CTAGACTGCAAGCTCCTTGAGGG - Intergenic
950549195 3:13655887-13655909 AGAGAGTGTCATCTCCTTAATGG - Intergenic
950956362 3:17057740-17057762 CTAGAGTGGAAACTCCTTGAGGG + Intronic
951027926 3:17849219-17849241 CTAGACTGTAAGCTCCATAAAGG - Intronic
951081784 3:18458889-18458911 TTAGAATGTAAGCTACTTAATGG + Intergenic
951372752 3:21871441-21871463 CTAAAGTGTAAACTTCTTGAAGG + Intronic
951561737 3:23974503-23974525 TCAGAATGTAAGCTCCTTAAAGG + Intronic
951997011 3:28742067-28742089 GTAGAGTGTTAGGTCCTTAAGGG + Intergenic
952150595 3:30585805-30585827 CTAGACTGTAATTTCCTTATGGG - Intergenic
952471735 3:33661265-33661287 CTAGATTATAGGCTCCTTAAGGG + Intronic
954113260 3:48447631-48447653 CTAGAATGTAAGCTCCATGAAGG - Intronic
954861936 3:53697455-53697477 CTAGACTGTAAGCTCCTTGCAGG - Intronic
955170380 3:56557922-56557944 CTGCACTGTAATCTCCTTAAGGG - Intronic
955200827 3:56850753-56850775 CTAGAGTGTGAGCCCCTTGAAGG - Intronic
955221492 3:57026876-57026898 CTAGACTGTAAGCTGCTTGAAGG + Intronic
955506819 3:59640702-59640724 CTAGAGGGTAACCTCCTTGAGGG - Intergenic
955540767 3:59973640-59973662 CTAGATTGTAACCTCCCTGATGG + Intronic
955568338 3:60274263-60274285 CTAGATTATAAACTCCTTGAGGG + Intronic
955713490 3:61804339-61804361 CTAGATTGTATCCTCCTTACTGG + Intronic
955766959 3:62355014-62355036 CTAGAGTGTAAGCTTCGTGAAGG - Intergenic
955799201 3:62668679-62668701 CTAGGCTGTAAGCTCCATAAGGG + Intronic
956203218 3:66729033-66729055 CTAGACTGTAACCGCCGTGATGG + Intergenic
956382462 3:68679285-68679307 CTAGAATGTAATCTCAATAAGGG + Intergenic
956694158 3:71904456-71904478 CAAGAGTGTAAACTCCCTAAGGG - Intergenic
956871457 3:73422106-73422128 CTAGAATGTAAGCCCCTTGAGGG + Intronic
957793636 3:84972820-84972842 CTAGACTGTAAACTCCATAAGGG - Intronic
958715863 3:97779489-97779511 CTAGCTTGTAAACTCCATAAAGG + Intronic
959123510 3:102262557-102262579 CTAGAATGAAAGCTCCATAAAGG - Intronic
959337415 3:105083435-105083457 CTAGACTCTGAGCTCCTTAAGGG - Intergenic
959641270 3:108639209-108639231 TTTGAGTGTAACCTCCATGAGGG + Intronic
959750384 3:109827577-109827599 CTAGGTTGTAAACTCCTTGAGGG + Intergenic
959871755 3:111336984-111337006 CTATAGTGTTGCCTGCTTAACGG - Intronic
960416957 3:117396753-117396775 CTAAACTGTAACCTCCATGAAGG + Intergenic
960721369 3:120627529-120627551 CCAGACTGTGAGCTCCTTAAGGG + Intergenic
960747511 3:120906858-120906880 CTAGACAGTAACCTTCTTGAAGG - Intergenic
960906862 3:122610342-122610364 ATAGACTGTAAGCTCCTTGAGGG + Intronic
960944316 3:122955967-122955989 TTAGACTGTAAGCTCCTTGAAGG - Intronic
961223903 3:125221640-125221662 TTAGATTGTAAGCTTCTTAAAGG - Intergenic
961237105 3:125376051-125376073 CCAAACTGTGACCTCCTTAATGG + Intergenic
961950209 3:130741741-130741763 CTAGAATGAAAGCTCCATAATGG + Intronic
962086527 3:132197495-132197517 CCAGACTGTAACCTACTTGAGGG + Intronic
962505644 3:136044398-136044420 CTAGACTGTAAGCTCCTTACAGG - Intronic
962515362 3:136144880-136144902 CTAGAGTGTTGCCTCCTTCACGG + Intronic
962727695 3:138248994-138249016 CTAGAATGTAAGCTCCATGAGGG + Intronic
962824937 3:139092254-139092276 CTAGAATGTCAGTTCCTTAAGGG + Intronic
962909081 3:139831413-139831435 CTAGAATGTAAACTCCTTGAGGG - Intergenic
962917589 3:139918616-139918638 CTGGAGTGTAAGCCCCTTGAGGG - Intergenic
963068493 3:141282548-141282570 CTAGAATATAACCTCCCTAAGGG + Intronic
963161089 3:142150646-142150668 CTAGAATGTAAGCTCCATGAAGG - Intergenic
963252415 3:143115476-143115498 CTAGAGTGTAAACTTCATGAAGG + Intergenic
963677229 3:148327506-148327528 ATAGAGTTTAAGCTCCATAAAGG + Intergenic
963770542 3:149382041-149382063 ATAGAGTGGATACTCCTTAAAGG - Intergenic
964673972 3:159257182-159257204 CTAGAATGTAAAATCCTTGAGGG - Intronic
964795735 3:160495093-160495115 CTAGATTGTAAGCTCCTTAAGGG - Exonic
964799680 3:160541818-160541840 GAAGAGTGCTACCTCCTTAAGGG - Intronic
965148354 3:164936711-164936733 CTAGACTGCAAGCTCCTTGAAGG + Intergenic
965167239 3:165210752-165210774 CCATACTGTAAACTCCTTAAAGG + Intergenic
965567400 3:170134813-170134835 CTAGATAGTAAGCTCCTTGAGGG - Intronic
965610593 3:170539603-170539625 CTAGACTGCAAACTCCTTGAAGG + Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966484029 3:180447671-180447693 ATAGATTTTAAACTCCTTAAGGG + Intergenic
966706945 3:182926454-182926476 CTAGAATGTAAGCTCCATGAGGG + Intergenic
967002495 3:185349669-185349691 CTAGACTGTAAGCTTCTTCAGGG + Intronic
967011704 3:185441434-185441456 ATAGATTGTAAGCTCCTTGAAGG - Intronic
967783218 3:193462409-193462431 AAAGAATGTTACCTCCTTAAAGG + Intronic
967832637 3:193933624-193933646 CTAGACTGTAAACTCCATGAGGG + Intergenic
967952053 3:194848655-194848677 CCAGAGTATGACCTCCTTGAGGG - Intergenic
968009920 3:195267624-195267646 CTAGACTCTAAACTCCTTAAGGG - Intronic
968196043 3:196707329-196707351 CATGATTGTAAGCTCCTTAAAGG + Exonic
970244076 4:14040371-14040393 CTTGAATGTATGCTCCTTAATGG - Intergenic
970548297 4:17152783-17152805 CTAGAATATAAGCTCCATAAGGG - Intergenic
970560885 4:17281199-17281221 CTAGAGTGTAAATTCCTCTAAGG - Intergenic
970663809 4:18314617-18314639 CTAGGCTGTAAGCTCCTTGATGG + Intergenic
970722427 4:19003340-19003362 CTAGAATGTAAACTCCATGAAGG - Intergenic
971193779 4:24452736-24452758 CTAGACTGTAAACTCCACAAAGG - Intergenic
971381329 4:26101065-26101087 CTAGATTCTAAGTTCCTTAAGGG - Intergenic
971440738 4:26682205-26682227 CTAGAATGCAGGCTCCTTAATGG - Intronic
972095008 4:35337714-35337736 CTAGAATGTAGCCTCCATGAGGG - Intergenic
972400190 4:38694470-38694492 CTAGAGTGTGAGCTCCTCGAGGG + Intronic
972474572 4:39438230-39438252 CTAGACTGTATGCTCCTTGAGGG - Intronic
972776689 4:42247798-42247820 CTAGACTGTAAATTCCTTCAGGG + Intergenic
973002559 4:44969239-44969261 CTAGAATGTAAACTCCACAAAGG + Intergenic
973011740 4:45083674-45083696 CTAGAATGTAAGCTTCTTGAGGG + Intergenic
973019667 4:45186908-45186930 ATAGAGTTTAACCTCCATGAGGG - Intergenic
973041882 4:45477942-45477964 CTAGGATGTAGCCTCCCTAATGG + Intergenic
973158822 4:46991874-46991896 CTTGAATGTAAGCTCCTTTAAGG + Intronic
973175184 4:47196903-47196925 CTAGAATGTCAGCTCCTTGAAGG + Intronic
973559102 4:52116403-52116425 CTAGACTGTAAGCACCTTAAAGG + Intergenic
973634866 4:52852487-52852509 CTAGAGTGTAAGCTCTGTAAGGG - Intergenic
973925321 4:55731044-55731066 CTAGAATGTAGACTCCTCAAAGG - Intergenic
973939189 4:55887439-55887461 CTAGAATGTAAACTTCATAAAGG - Intronic
974026577 4:56738237-56738259 CTAGACTGTAAGCTCCATGAGGG - Intergenic
974167069 4:58217097-58217119 CTAGTGTGCAAACACCTTAAGGG - Intergenic
974826535 4:67138120-67138142 CTAGACTGTAAACTCCTTGAAGG + Intergenic
974943711 4:68500744-68500766 CTAGACTGTAAACTCCATGAGGG + Intergenic
975113671 4:70654717-70654739 CTAGAGTGTAATCTCCACGAAGG - Intronic
975138098 4:70893884-70893906 CTAGAATGTAAACTTCTTAGGGG + Intergenic
975375845 4:73645013-73645035 GTAGTGTGTAACCTTCTTATTGG + Intergenic
975416830 4:74114258-74114280 CTAGAATGTCAGCTCCATAAGGG - Intronic
975496784 4:75044551-75044573 CTAGACTGTAACCTCCATGCAGG - Intronic
975525715 4:75348197-75348219 CTAGAATGTAAGCTCCATGAGGG - Intergenic
975645634 4:76543113-76543135 CTAGTCTGTTACCTCCTTGAAGG - Intronic
975664834 4:76725371-76725393 GCAGAATGTAAGCTCCTTAAAGG + Intronic
975793931 4:77985671-77985693 CTAGAATGTAAGCTCCATGAAGG - Intergenic
975876457 4:78843392-78843414 CTAGAATGTAAGCTCCATGAGGG + Intronic
976346059 4:84002986-84003008 CTAGACTGTAAGCTCCATAAAGG - Intergenic
976431984 4:84972808-84972830 CTAGACTGTGAGCTCCATAAAGG - Intergenic
976461472 4:85317135-85317157 CTAGACTATGAGCTCCTTAATGG + Intergenic
976717104 4:88134936-88134958 CTAGAATGTAAACTCCACAAGGG - Intronic
976768944 4:88630486-88630508 CTAGAGTGTAAGCTCCAGGAAGG - Intronic
977313197 4:95412439-95412461 CTAGACTGGAAGCTCCTTGAAGG + Intronic
977697193 4:99979825-99979847 CTAGAATGTAAGCTCCTTGAAGG - Intergenic
977728942 4:100329197-100329219 CTAGAGTGTAACTTGCATATTGG - Intergenic
977963846 4:103119242-103119264 CTAGAATGTAAGTTCCTTGATGG + Intronic
977991670 4:103450575-103450597 CTAGAATGTAAATTCCATAAGGG - Intergenic
978078116 4:104558514-104558536 CTAGACTGTGAACTCCTCAAAGG - Intergenic
978129265 4:105174874-105174896 TAAGAGTGTAACCTCCCAAAGGG + Intronic
978470070 4:109055668-109055690 CTAGACTGTAAGCTCATGAAGGG + Intronic
978797679 4:112724485-112724507 CTAGAATGTAAACTCCATGAGGG - Intergenic
978836623 4:113158013-113158035 CTAGACTGTCAGCTCCTTGAGGG - Intronic
979696111 4:123614960-123614982 CTAGAGTGTAAGTTCCTACAAGG + Intergenic
979715808 4:123835924-123835946 CTAGACTATAAACTCCTTGAGGG - Intergenic
979771946 4:124536995-124537017 TTAGAATGTATGCTCCTTAAAGG - Intergenic
980973392 4:139587832-139587854 CTAGAGCATAATCTCCTTAAGGG - Intronic
981425643 4:144600041-144600063 CTAGAATGTAAACTCCTCAAAGG - Intergenic
981707123 4:147671538-147671560 CTAGACTGTAAGTTCCTTGAGGG + Intronic
981723650 4:147825918-147825940 CTAGAATCTAACCTCCATGAAGG - Intronic
981727063 4:147859637-147859659 CTAGAATGTAAGCTTCTTGAAGG + Intronic
981778588 4:148398740-148398762 CTAGAATGTAAGCTCCATGAGGG - Intronic
981886059 4:149674401-149674423 CTAGAATATAATCTCCATAAAGG - Intergenic
981891624 4:149745323-149745345 CTAGAATGTAACTTCCATAAAGG + Intergenic
982236454 4:153255146-153255168 CTAGATTGTGACCTCCCTGAGGG + Intronic
982592002 4:157325497-157325519 GAAGACTGTAATCTCCTTAAGGG - Intronic
982696082 4:158602666-158602688 ATAGAGTATAAACTTCTTAAAGG + Intronic
982833912 4:160098527-160098549 TTAGAATGTAAGCTCCTTGAAGG + Intergenic
983090978 4:163501957-163501979 CTAGATTGTAAACTCCATGAAGG + Intronic
983472297 4:168172626-168172648 CTAGAATGTAAGCATCTTAAGGG - Intronic
983870841 4:172823370-172823392 TTAGAATGTAAACTCCATAAGGG + Intronic
984100149 4:175474544-175474566 CTAGAGTATCAACTCCTCAAAGG - Intergenic
984168445 4:176332131-176332153 CTAGACTGTAAGCTCTTTGAGGG + Exonic
984674089 4:182526602-182526624 CTAGAATGTAAACTCCATGAAGG + Intronic
984805730 4:183749618-183749640 TTAGACTATAACCTCCATAAGGG - Intergenic
985046228 4:185942765-185942787 CTACATTGTAAACTCCTTAAAGG - Intronic
985969187 5:3361939-3361961 CTAGAATGCAGCCTCCTTGAGGG - Intergenic
986407243 5:7438335-7438357 GTAGAGTGTAAGCTCCATGAGGG - Intronic
987424717 5:17759520-17759542 CTAGATTTTAAACTCCTTAAGGG + Intergenic
987683956 5:21172252-21172274 CTAGAATGTAAGCTCCATAAAGG + Intergenic
987743389 5:21938356-21938378 CCAGACTGTAAGCTCCTTGAAGG - Intronic
987757191 5:22111210-22111232 CAAGAGTGTTACCTCCATAGTGG - Intronic
987793241 5:22595569-22595591 CTAGAAAGTAAACTCATTAAGGG + Intronic
988363548 5:30266711-30266733 CTAGAGTTTAGCCTCCTTTCTGG - Intergenic
988673544 5:33408034-33408056 CTAGACTGTAAGCCTCTTAAAGG - Intergenic
988815205 5:34827838-34827860 ATAGAGTATAAACTCCTTGAGGG - Intronic
989428934 5:41329332-41329354 CTAGACTGTAAGCTCTTTGAGGG + Intronic
989857702 5:46318486-46318508 CTAGAGTTAAACCTCCTTATTGG - Intergenic
990399430 5:55423256-55423278 CTAGAATGTAAACTCCATGAAGG - Intronic
990605242 5:57403212-57403234 CTAGACTGTAAACTCCTTGAGGG - Intergenic
990649759 5:57885039-57885061 CTTGAATGTAAGCTCCATAAGGG - Intergenic
990943581 5:61228237-61228259 CCATAGTGCAAACTCCTTAAGGG + Intergenic
991568050 5:68025540-68025562 CTGGAATGTAAGCTCCATAAAGG - Intergenic
991585424 5:68196807-68196829 CTAGAGTATAAACTCCGTGAGGG - Intronic
991749523 5:69786143-69786165 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991763586 5:69948497-69948519 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991783739 5:70169632-70169654 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991801103 5:70365961-70365983 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
991827497 5:70644085-70644107 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991842816 5:70823557-70823579 CCAGACTGTAAGCTCCTTGAAGG - Intergenic
991876185 5:71170007-71170029 CCAGACTGTAAGCTCCTTGAAGG + Intergenic
992174453 5:74135814-74135836 CCAGAATGTAAACTCCATAAGGG - Intergenic
992389097 5:76314095-76314117 CTAGAATGTTAGCTCCTTGAGGG + Intronic
992539068 5:77743899-77743921 CTAGAGTGTAAGTTCTTTGAGGG - Intronic
992718484 5:79534984-79535006 CTAGATTGTAAACTTCTCAAGGG - Intergenic
992766650 5:80007030-80007052 CTTGAGTGTAAGCTCCACAAGGG - Intronic
992825282 5:80543531-80543553 CTAGACTGTAAATTCCTTTATGG + Intergenic
992905502 5:81341672-81341694 CTAGACTGTAAGCTCCCTGAGGG - Intronic
992980990 5:82171911-82171933 CTAGACTGTAAGCTCCTTGATGG - Intronic
993330058 5:86588608-86588630 CTAGACTGTAACCTACTTTAAGG + Intergenic
993825289 5:92676831-92676853 CTAGAGTATAATCTCCCTACAGG - Intergenic
993872753 5:93271474-93271496 CTAAATTGTAAGCTCCTTTAGGG - Intergenic
993908876 5:93655993-93656015 CTAAAATGTAAACTCCTTCAGGG + Intronic
994027607 5:95102764-95102786 CTAATGTATCACCTCCTTAAGGG - Intronic
995227554 5:109718749-109718771 CTAGAATGTTAGCTCATTAAGGG + Intronic
995327630 5:110909161-110909183 GTAGATGGTAAGCTCCTTAATGG - Intergenic
995500946 5:112806292-112806314 CTAGACTGTAAGCTCCAGAAAGG + Intronic
995665548 5:114537810-114537832 CTAGAATGTAAGGTCCTTCATGG + Intergenic
996200905 5:120672039-120672061 CAAGACTGTAACCTCCCAAAGGG - Intronic
996301409 5:121990692-121990714 CTAGAGTGTAAGCTCTTCAAGGG - Intronic
996381058 5:122863071-122863093 CTAGAATGCAAGCTCCTTGAAGG - Intronic
996595979 5:125203310-125203332 CTAGAATGTAAACTTCTGAAGGG + Intergenic
996807006 5:127467333-127467355 CTAGAATGTAAGCTCCATGAGGG + Intergenic
997212473 5:132085601-132085623 CTAAAGTGTAAGCTCCTCAAGGG - Intergenic
997293877 5:132757561-132757583 CTAGACTGTGAGCTCCTTGAGGG + Intronic
997791194 5:136763915-136763937 CCAGACTGGAAGCTCCTTAAAGG - Intergenic
997868210 5:137483435-137483457 CTAGAATGTAAGCTCCATAAGGG + Intronic
998079697 5:139264432-139264454 CTAGAATGTAAGCTCCATGAAGG + Intronic
998171607 5:139875343-139875365 CTAGAATGTAAGCTCCATTAGGG + Intronic
998211968 5:140206352-140206374 CTGGAGTATAAGCTCCTTGAAGG + Intronic
998244953 5:140491765-140491787 TTAGACTGTAAGCTCCTTAAGGG + Intronic
998474247 5:142407413-142407435 CTAGCGTGTGACCTCCATGAGGG - Intergenic
998500101 5:142625123-142625145 CTAGACTGTAAACTCCTTAAAGG - Intronic
998515209 5:142747482-142747504 CTAGACTATAAGCTCCTTAAGGG - Intergenic
998637361 5:143971151-143971173 ATAGAATGTAAGCTCCATAAGGG - Intergenic
998798816 5:145847282-145847304 CTAGAAGGTAAGCTCCTTAAGGG - Intergenic
998813304 5:145987676-145987698 CTAGATTGTAAGCTCCATGAAGG + Intronic
998987381 5:147775884-147775906 CTAGAATGTAAGCTCCATGAGGG - Intronic
999135083 5:149313276-149313298 CTTGACTGTAATCTCCTTAAGGG - Intronic
999227137 5:150035033-150035055 CTAGACTGTAAGCTCTTCAAGGG - Intronic
999279960 5:150358455-150358477 CTAGAGTGTAAGCTCCAGGAGGG - Intronic
999466508 5:151811263-151811285 TTAGACTGTAAGCTCCTTATGGG + Exonic
999641048 5:153673435-153673457 CTAGAATATAAGCTCCATAAGGG + Intronic
999660661 5:153859632-153859654 CTAGAATGTAACCTCCATGAGGG - Intergenic
999811540 5:155132054-155132076 TTAGACTCTAAACTCCTTAAAGG + Intergenic
999820201 5:155219718-155219740 CTAGACTGTAACTTCCATGAAGG - Intergenic
1000161670 5:158603609-158603631 CTAGACTATAAGCTCCTTGAAGG + Intergenic
1000342844 5:160290680-160290702 CTAGACTGTAACCACCATGAGGG + Intronic
1000649311 5:163796824-163796846 TTAGATTATAAACTCCTTAAGGG + Intergenic
1000690929 5:164319863-164319885 CTAGACTGTAAGCTCCATGAAGG - Intergenic
1000927441 5:167210924-167210946 CTAGATAGTAAACTCCTGAAGGG - Intergenic
1001133413 5:169082472-169082494 CTAAATTGTAAACTCCTCAAGGG + Intronic
1001170972 5:169418694-169418716 CTAGAATGTAAACTCCATGAGGG - Intergenic
1001174176 5:169449914-169449936 CTAGAATGTAAGTTCCTCAAGGG + Intergenic
1001451181 5:171825715-171825737 CTAGACTCTGAGCTCCTTAAGGG + Intergenic
1002065565 5:176650064-176650086 CTGGAGTGTAAGCTCCGTGAGGG + Intronic
1002340221 5:178511595-178511617 CCAGAGTTTAACCTCCTCCAGGG - Intronic
1002366476 5:178716558-178716580 CCAAAGTATAAGCTCCTTAAAGG - Intronic
1003363594 6:5452008-5452030 CAAGAGTCTAACCTCCTTGAAGG + Intronic
1003383029 6:5641965-5641987 CTAGACTGTTAACTCCTTGAGGG + Intronic
1003589226 6:7423246-7423268 CTATAGTGTAAGCTCCACAAGGG + Intergenic
1003878208 6:10456865-10456887 CCAGAATGTAGGCTCCTTAAAGG + Intergenic
1004662100 6:17719735-17719757 CTAGAGTGTCACCTGGCTAATGG - Intergenic
1005092725 6:22075272-22075294 CTAGACCGTAAACTCCTTGAGGG - Intergenic
1005659356 6:27979198-27979220 CTAGATTGTAAGTTCCTTGATGG + Intergenic
1005720507 6:28597064-28597086 CCAGATGGTAACCTTCTTAAGGG - Intronic
1006725771 6:36197748-36197770 CTAGACTGTAAGCTCCTTGTGGG + Intronic
1006761161 6:36462709-36462731 CTAGATTGTAAGCTCTTTGAAGG + Intronic
1007011019 6:38417413-38417435 CTAGAATGTAATCTCCTAAAGGG + Intronic
1007016567 6:38473710-38473732 CTAGATTGTAAGCTCCATGAAGG - Intronic
1007143342 6:39600400-39600422 CTAGATTGTAAGTTCCTTGAGGG - Intronic
1007293534 6:40804487-40804509 CTGGAATGTAAGCTCCATAAAGG - Intergenic
1007598361 6:43065955-43065977 CTAGACTGTGAACTCCTTACTGG - Intronic
1007698472 6:43749004-43749026 TTAGAGAGTAAGCTCCCTAAAGG - Intergenic
1007908261 6:45486277-45486299 CTAGACTGTGAACTCCTTGAGGG + Intronic
1008090689 6:47290909-47290931 CTAGAATGTAAACTTCATAAGGG - Intronic
1008766667 6:54925340-54925362 CTAGAATGTAAGCTTCATAAGGG + Intronic
1008891996 6:56505313-56505335 CTTGCGTGTGACCTCCTAAATGG + Intronic
1008932091 6:56952080-56952102 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1010121849 6:72385628-72385650 CTAGAATGTAACCTCCATTGGGG + Intronic
1010742406 6:79524648-79524670 CTAGAGTGTAAATTCCCTAAGGG - Intronic
1010890204 6:81298388-81298410 CTATAGTGTAAGCTCCTTGAAGG + Intergenic
1011017824 6:82778024-82778046 CTAGTTTGTAATCTCATTAATGG + Intergenic
1011023255 6:82837412-82837434 CTAGAGCGTAACCTCCTTAAGGG + Intergenic
1011717058 6:90117558-90117580 CTCAACTGTAAGCTCCTTAAGGG + Intronic
1011826861 6:91318052-91318074 CTAGACTGATATCTCCTTAAGGG + Intergenic
1012383667 6:98651902-98651924 CTAGATTGTAACCTTTTTGAGGG - Intergenic
1012413485 6:98987184-98987206 CTAGAGTGTAATCTCCATGGGGG + Intergenic
1013118781 6:107123183-107123205 CTAGAATGTAAACTCCTGGAGGG + Intergenic
1013825546 6:114206252-114206274 CTAGACTGTAAACTCCTTGAGGG + Intronic
1014049053 6:116930440-116930462 CTAGAATGTAAACTTCTTACAGG - Intronic
1014080792 6:117283672-117283694 CTGGAATGTAACCTCCATCAAGG + Intergenic
1014218803 6:118779579-118779601 CTAGCGTGCATCCTTCTTAACGG + Intergenic
1014489325 6:122042833-122042855 CTAGAATGTTAGCTCCTTGAGGG - Intergenic
1014539427 6:122655634-122655656 CTAGACTGTTACCTCCATGAAGG - Intronic
1014667733 6:124260240-124260262 CTAGGATGTAAGCTCCTTGAAGG - Intronic
1015601076 6:134911238-134911260 ATAGAGTGCAAACTCCTTGAAGG + Intergenic
1015769759 6:136756417-136756439 CTAGACTAGAAGCTCCTTAAGGG + Intronic
1015949176 6:138534295-138534317 CTAGATTGTAAGCTCCTTGAGGG - Intronic
1016077766 6:139817765-139817787 CTAGAATTTAACCTCCAGAAGGG - Intergenic
1016329042 6:142936797-142936819 CTAGAATGTAAACTCCATGAAGG + Intronic
1016349817 6:143155222-143155244 GTAGAATGTAAACTCCATAAGGG - Intronic
1016440449 6:144077820-144077842 TTAGAGTATAAATTCCTTAAAGG + Intergenic
1016521073 6:144947512-144947534 CTAGAATGTAAACTCCACAAGGG + Intergenic
1016707995 6:147135846-147135868 CTAGATTGTGAGCTCCTTAAGGG + Intergenic
1016920738 6:149290474-149290496 CTAGAATGTAAACTCCACAAAGG + Intronic
1017937467 6:159019154-159019176 GTAGACTATAACTTCCTTAAGGG - Intergenic
1017965195 6:159258256-159258278 CCAGACTGTAAGCTCCTTGAGGG - Intronic
1018039632 6:159910540-159910562 CTAGACTATAAGCTCCTTGAGGG + Exonic
1018129057 6:160710786-160710808 CTAGAATGTAAGCTCCATGACGG + Intronic
1018308962 6:162488841-162488863 CTAGAGTGTAAACTCCATGAGGG - Intronic
1018464467 6:164030977-164030999 TTAGAGTGTAAGCTCCTTGAGGG - Intergenic
1018550856 6:164997169-164997191 CTACAGTGAAACCTGCCTAACGG + Intergenic
1021867498 7:24972511-24972533 CTAGTCTGTAAGCTCCTTGAAGG + Intronic
1021908575 7:25361333-25361355 CTAGAATGTAAGCTTCTTGAAGG + Intergenic
1022121612 7:27313827-27313849 CTACAATGTAAGCTCCTTAAGGG + Intergenic
1022129427 7:27390791-27390813 CTAGGGTGTAAGCTCCATGAGGG + Intergenic
1022575012 7:31489055-31489077 CTAGACTGTAAGCTCCTTAAGGG - Intergenic
1022839697 7:34151360-34151382 CTAAAATGTAAGCTCCTTGAGGG - Intronic
1022881893 7:34596215-34596237 CTAGACTGTGAGCTCCTTGAGGG + Intergenic
1022882663 7:34604775-34604797 CTAGACTGTAAACTCCATGAAGG - Intergenic
1023579397 7:41665284-41665306 TTAGAATGTAAGTTCCTTAAAGG + Intergenic
1023759040 7:43446539-43446561 CTAGATTGTAAGCTCATCAAGGG + Intronic
1023759624 7:43452626-43452648 CTAGACTGTAAGCTCCATGAGGG - Intronic
1023942059 7:44775525-44775547 CTAGACTGTAAGCTCCATGAGGG + Intergenic
1024520309 7:50299861-50299883 CTAGATTGTGAGCTCCTTAAGGG + Intergenic
1024839215 7:53565389-53565411 CCAGACTGTGAACTCCTTAAAGG + Intergenic
1024957558 7:54940585-54940607 CTAGAGTATAAGCTCCATGAGGG - Intergenic
1025606688 7:63044616-63044638 CTAGATTGTAAGCACCTTGAGGG + Intergenic
1026056219 7:66986041-66986063 CTAGACTGTGAGCTCCTTAAGGG - Intergenic
1026280214 7:68915588-68915610 CTAGAATGCAAACTCCATAAGGG - Intergenic
1026431547 7:70352400-70352422 CTAGACTGTAAACTCCCTGAGGG + Intronic
1026721867 7:72839027-72839049 CTAGACTGTGAGCTCCTTAAGGG + Intergenic
1027387304 7:77671393-77671415 CTAGATTGTAACATCCCGAAGGG + Intergenic
1027690048 7:81333640-81333662 CTACAGTGGATCCTCTTTAAAGG - Intergenic
1027889786 7:83957077-83957099 CTAGACTGTGAGCTCCTTGAGGG - Exonic
1028101133 7:86822282-86822304 CTATATTGTAAACTCCTTAAAGG - Intronic
1028326965 7:89539905-89539927 CCAGAGTGTACCCTTCTTCAGGG - Intergenic
1028538009 7:91910824-91910846 CTAGAATGTAAGCTCCACAAAGG - Intergenic
1028772249 7:94639650-94639672 ATAGATTGTAAGCTCCTTCAGGG - Intronic
1029234101 7:99098828-99098850 ATGCAGAGTAACCTCCTTAAAGG - Intronic
1029799619 7:102932981-102933003 CTAGAAAGTAAACTCCTTAAGGG - Intronic
1030148389 7:106379047-106379069 CTAGACTGTGAGCTCTTTAACGG + Intergenic
1031131930 7:117842906-117842928 CTAGAATGTAAGCTCCATGAGGG - Intronic
1031183229 7:118443455-118443477 CTAGACTGTAAGCTCCATCAAGG - Intergenic
1031238202 7:119204521-119204543 CTAGTTTTTAAACTCCTTAAGGG - Intergenic
1031347774 7:120690792-120690814 CTAGAATGTAAGATCCATAAGGG - Intronic
1031423007 7:121571832-121571854 CTAGAGTAAAACTTCGTTAAGGG - Intergenic
1031667341 7:124500716-124500738 CTAGTGTGTAGCATCCTTGAGGG + Intergenic
1031742106 7:125446438-125446460 CTAGTGTGTAAGCTCCATAAAGG - Intergenic
1031900801 7:127408559-127408581 TTAGACTGTAAACTCCTTGAGGG - Intronic
1032171752 7:129590567-129590589 CAAGAGTGTAAACTGCTTCAAGG - Intergenic
1032338746 7:131050777-131050799 CTAGAATGTTACCTCCATGAAGG + Intergenic
1032555750 7:132832904-132832926 CTAGAGTATGAGCTCCATAAGGG + Intronic
1033478083 7:141710193-141710215 CTAGACTGTAAGCTCTTTGAGGG - Intronic
1033645766 7:143302508-143302530 CTGGAGTGTAAGCTCCATGACGG + Intronic
1033761460 7:144440841-144440863 CTAGAATGTAATCTCCATGAGGG - Intergenic
1034771729 7:153785302-153785324 CTAGACTGTAAGCTCCATGAGGG + Intergenic
1035492928 7:159295759-159295781 CTAGAGTGGAACCTCGTCATCGG - Intergenic
1036195959 8:6715138-6715160 CTAGAATGTGACCTCCATAATGG - Intronic
1036528615 8:9559131-9559153 CTAGACTGTAAGCTCCATAAGGG - Intronic
1036571243 8:9981518-9981540 CTAGACTGCAAGCTCCTTAGAGG + Intergenic
1036778246 8:11628357-11628379 CTAGACTGTAAGCACCTTGAGGG - Intergenic
1036944683 8:13083459-13083481 CTAGATTGTAAGCTCTTTGAGGG - Exonic
1037357325 8:18035186-18035208 TTAGAATGTAAGCTCTTTAAGGG + Intergenic
1037474894 8:19247450-19247472 CTAGAATGTAATCTCTTTGAGGG - Intergenic
1037602458 8:20408949-20408971 CTAAATTGTAATCTCCTTAAAGG - Intergenic
1037827339 8:22167280-22167302 CTGGACTGTAAGCTCCTTGAAGG - Intronic
1037918907 8:22790273-22790295 CTGGACTGTGACCTCCTTGAGGG - Intronic
1037934585 8:22906823-22906845 CTAGAATGTAAGCTCCATGAGGG - Intronic
1038020569 8:23549115-23549137 CTAGACTATAAACTCCTTGAAGG + Intronic
1038399484 8:27272088-27272110 CTAGACTGTACACTCCTTGAAGG - Intergenic
1038466707 8:27771638-27771660 CTAGAGTGTAAGTCCCTTGAGGG - Intronic
1039826371 8:41177421-41177443 CTAGACTGGAACTTCCTTGAGGG + Intergenic
1039914475 8:41849574-41849596 ATAGAGGGTAACCCCCTTGAAGG + Intronic
1040064376 8:43133289-43133311 CTAGAATGTAAGCTCCATGAAGG - Intergenic
1040417132 8:47205490-47205512 CTAGAATGTCAGCTTCTTAAGGG + Intergenic
1040625826 8:49149051-49149073 AAAGAATATAACCTCCTTAAGGG - Intergenic
1040676995 8:49762386-49762408 CTAGCTTGTAAGCTGCTTAAAGG + Intergenic
1040711126 8:50190158-50190180 GTAGACTGTGAGCTCCTTAAAGG - Intronic
1041012007 8:53553351-53553373 GTAGACTGTGACCTCCTTGAAGG - Intergenic
1041689588 8:60676178-60676200 CTAGATTGTAAACTCCATGAGGG + Intergenic
1041767209 8:61431676-61431698 CTAGAGTATAAGCTCCTTGAAGG + Intronic
1041961257 8:63618765-63618787 CTAGAATGTAAGCTCCATGAAGG + Intergenic
1042206316 8:66333242-66333264 CTAGACTGTGAGTTCCTTAAGGG - Intergenic
1042834325 8:73064425-73064447 CTAGAGTGTGACCTCCCTCACGG + Intergenic
1042939111 8:74089648-74089670 CTAGAGTGCAAACTCCATGAGGG - Intergenic
1043028017 8:75095525-75095547 CTAGACTGTCAACTCCTCAAAGG - Intergenic
1043184114 8:77123950-77123972 CTAGAGTATAAACTCCACAAGGG + Intergenic
1043203808 8:77409664-77409686 CTAGGATATAACCTCCTTGAGGG - Intergenic
1043299419 8:78707902-78707924 CTAGATTGTAAGCTCCATGATGG + Intronic
1043369527 8:79574911-79574933 CTAGAGTGTAAGATCCATGAGGG - Intergenic
1043473289 8:80582075-80582097 CTAGAATGTAAACTCCCTATTGG + Intergenic
1044150331 8:88769010-88769032 CTAGAGTGTAAACTACTTAAAGG + Intergenic
1044186945 8:89264662-89264684 CTAGATAGCAACCTCCTTAGGGG + Intergenic
1044254426 8:90044001-90044023 CTAGACTGTAAACTCCTTAGTGG - Intronic
1044288355 8:90437569-90437591 CTAGACTGTAAACTCTATAAGGG - Intergenic
1044485216 8:92744575-92744597 CTAGAGTATAAGCTCCTCTATGG - Intergenic
1044611823 8:94099242-94099264 ATAGATTATAACCTCCTTGAGGG - Intergenic
1044809776 8:96047706-96047728 CTAAAATGTAAGCTCCATAAGGG - Intergenic
1045045993 8:98278641-98278663 CTAGACTATAAGCTCCTTGAAGG + Intronic
1045200865 8:99979821-99979843 TTAGACTGTAACCTCTTTGAGGG - Intronic
1045278677 8:100729704-100729726 CTAGAAAGTAAGCTCCATAAGGG - Intergenic
1045412994 8:101937783-101937805 CAAGAGTGTAAGCTCCATGAGGG - Intronic
1045413802 8:101946331-101946353 CTACATTGTAAATTCCTTAAAGG - Intronic
1045659187 8:104418872-104418894 CTAGACTGTCAGCTTCTTAAAGG + Intronic
1045679893 8:104647328-104647350 CTAGAGTGTCAGCTCCGTGAGGG + Intronic
1045842504 8:106596478-106596500 CTGGATTGTAAGCTCCTTGATGG - Intronic
1046022044 8:108676692-108676714 CTAGAATGTAAACACCTTGAGGG + Intronic
1046126781 8:109920194-109920216 CCAGAGTGTAAGCTCCTTAAAGG - Intergenic
1046552884 8:115738862-115738884 CTAGACTGTGACCTTCTTCAGGG + Intronic
1046604527 8:116356197-116356219 CTGGTGTGTAAGCTCCCTAAGGG - Intergenic
1046822123 8:118645284-118645306 CTAGATTCTAACCTCCCTGAAGG + Intergenic
1046970935 8:120222822-120222844 ATAGAGTTTAAGCTCCTTGAGGG - Intronic
1047073866 8:121378021-121378043 CTAAACTATAATCTCCTTAAAGG + Intergenic
1047528868 8:125657281-125657303 CTGGACTGAAAACTCCTTAAAGG + Intergenic
1047764606 8:127980347-127980369 CTAGACTATAACCTCCGTAAGGG - Intergenic
1047863671 8:128997051-128997073 CTAGAATGTAAGCTTCTTGAAGG + Intergenic
1048162066 8:132030685-132030707 CTAGAGTGAAAACTTCTTTAGGG + Intronic
1048424796 8:134312868-134312890 CTAGAATCTGAGCTCCTTAAGGG + Intergenic
1048475573 8:134739635-134739657 CTAGACTGGGAGCTCCTTAAGGG - Intergenic
1048566102 8:135599664-135599686 CTAGTCTGTAAGGTCCTTAAGGG - Intronic
1049676621 8:143892086-143892108 ATAGAGAGAAACCTCCTAAAAGG + Intergenic
1049994375 9:1020740-1020762 CTAGAATGTAAACTCCATAAAGG - Intergenic
1050010555 9:1181864-1181886 CTAGAATGTAAGCTCCATCATGG - Intergenic
1050054070 9:1633374-1633396 CTAGAATGTAAGCTCCATGAAGG + Intergenic
1050084549 9:1950995-1951017 CTAGGCTGTAAACTTCTTAAGGG - Intergenic
1050143819 9:2544511-2544533 CTAGACTGTAAGCTCCACAAGGG - Intergenic
1050307873 9:4323735-4323757 CTTGACTGGAAGCTCCTTAAAGG + Intronic
1050620515 9:7447338-7447360 CTAGATTGTAAGCCCCTTGAAGG + Intergenic
1050998684 9:12252871-12252893 CTAGAGTGTAAGCCCCATGAAGG - Intergenic
1051208432 9:14714610-14714632 CTAGATTATAAACTCCTTAATGG - Intergenic
1051399354 9:16662974-16662996 ATAGACTGTAACCTCCTTGAGGG - Intronic
1051875009 9:21783410-21783432 GTAGAGTATAAGCTCCTTAGAGG + Intergenic
1052403166 9:28026262-28026284 CTAGACTGTAAACTCCTTAAAGG + Intronic
1052602706 9:30657478-30657500 ATAGAATGTAAACTCCTCAAAGG - Intergenic
1052678129 9:31652961-31652983 CCAGTGTGTAAGCTCCATAAAGG + Intergenic
1052805771 9:33011767-33011789 GTAGACTGAAAGCTCCTTAAGGG - Intronic
1053276327 9:36786358-36786380 GTAGAGTGTAAGCTCCATGAGGG - Intergenic
1053405128 9:37867553-37867575 CTAGACTGTAAGCTCCTTGAGGG + Intronic
1054803778 9:69378865-69378887 CTAGACTGTGAGCTCCTTAATGG - Intronic
1055422369 9:76158114-76158136 TTAGACTGTAACCTCCACAAGGG - Intronic
1055840833 9:80501035-80501057 CTAGAATGTAAACTCCATGAAGG + Intergenic
1056235900 9:84594026-84594048 TTTAAGTGTAAGCTCCTTAAAGG - Intergenic
1057846201 9:98526619-98526641 CTAGAATGTAAGCTCCTTGAGGG + Intronic
1058001966 9:99875208-99875230 CTGGATTATAAGCTCCTTAAAGG - Intergenic
1058339317 9:103874845-103874867 CTAGATTGTAAACCACTTAAAGG + Intergenic
1058420267 9:104826800-104826822 CTAGATTCTAAGCTCTTTAAGGG - Intronic
1058515675 9:105771913-105771935 CTAGTCTGTAAGCTCCTTGAGGG + Intronic
1058822171 9:108742570-108742592 CTAGAATGTCAGCTCCTTGAGGG + Intergenic
1058824780 9:108765503-108765525 CTAGAGTGTAAACTTCACAAGGG - Intergenic
1058995866 9:110298266-110298288 TTAGAGTGTCTCCTCCTTAGAGG - Intergenic
1059127031 9:111699028-111699050 CTAGACTATAAGCTCCTTAAAGG - Intronic
1059393328 9:114014483-114014505 TTAGACTGTAAACTCCTTGAAGG + Intronic
1059406564 9:114101813-114101835 CTAGAGGGTAAGCTCCATAAGGG - Intergenic
1059422815 9:114203164-114203186 TTAGAATGTAAACTCCTTTAGGG + Intronic
1059484869 9:114618851-114618873 CTAGAGTGTAAGCTCCCTGAAGG + Intronic
1059638269 9:116191550-116191572 CTAAAGTGGAAGCCCCTTAATGG - Intronic
1059870561 9:118569169-118569191 CTAGAATGTAAGCTTCTTGAGGG + Intergenic
1059993512 9:119887634-119887656 CCAGACTGTAAACTCCTTGAGGG - Intergenic
1060043489 9:120322056-120322078 CTAGGGTGTAAACACCTTGAGGG + Intergenic
1060262731 9:122090727-122090749 CTAGAATGTAAGCTCCATGAGGG - Intronic
1060303976 9:122393993-122394015 CTGGAGTGTGAGCTCCATAAGGG - Exonic
1060427556 9:123519249-123519271 CTACAGTGTAAGCTCCTTGAAGG + Intronic
1060456070 9:123799406-123799428 CTAGACTGTAAACTCCTGGAGGG - Intronic
1060965303 9:127709185-127709207 CTAGAATGTAAACTCCATGAGGG - Intronic
1061341948 9:129989563-129989585 CTAGAATGCAAGCCCCTTAAGGG - Intronic
1061441238 9:130605260-130605282 CTAGACTGTAAGCTCCCTGAGGG + Intronic
1061736659 9:132665362-132665384 CTAGTGTGTAACTTCCTCAAGGG - Intronic
1061739845 9:132694218-132694240 CTAGATTGTAAGCTCCTCAAGGG + Exonic
1186640679 X:11451786-11451808 CTAGACTGGAAACTCCTTGAAGG + Intronic
1186787183 X:12964480-12964502 CTAGAAAGTAAACTCCTTAAAGG + Intergenic
1187252043 X:17607385-17607407 CTAGAGTAGAACCTCCCCAAGGG - Intronic
1187409019 X:19031589-19031611 CTAGATTGTATGCTCCTTGAGGG - Intronic
1188343992 X:29041430-29041452 CTAGACTATAAGCTCCTTAGAGG - Intronic
1189004521 X:36982189-36982211 TTAGAATGTAAGCTCCATAAGGG - Intergenic
1189044453 X:37575355-37575377 TTAGAATGTAAGCTCCATAAGGG + Intronic
1189232321 X:39462144-39462166 CTAGATTGTAAGCTCCTTGAGGG - Intergenic
1189497853 X:41525561-41525583 CTAGCGGGTACCCTCCTTGAAGG + Intronic
1190338186 X:49275648-49275670 CTAGACTGTAAGCTCCGTGAGGG + Intronic
1191693883 X:63968268-63968290 CTAGAGTGTGAACTCTTTGAGGG - Intergenic
1191780264 X:64856854-64856876 CTAGAATGTAAGCTCCTTAGGGG + Intergenic
1191897439 X:66007976-66007998 CTAGAGTGTAAGCTCCATGAGGG - Intergenic
1192082686 X:68063668-68063690 CTAGAATGTAAGCTCCATGAGGG - Intronic
1192372260 X:70524203-70524225 CTAGAATGTAAGCTCTTTGAAGG + Intergenic
1192425278 X:71069422-71069444 CTAGAATGTTAACTCCTTGAGGG - Intronic
1192588923 X:72343628-72343650 CTAGAATGTAATCTCCATGATGG + Intronic
1193123567 X:77848217-77848239 CTAGAGTGTAATCTTCTTCATGG - Intronic
1193275096 X:79576972-79576994 CTAGACTGTAAGCTTCATAATGG - Intergenic
1193811701 X:86059054-86059076 CTAGAATGTAAGCTCCATGAGGG + Intergenic
1194403462 X:93466005-93466027 CTAGAGTGATTTCTCCTTAAGGG + Intergenic
1194532179 X:95064039-95064061 TTAGAGTGTAAAGTCTTTAATGG + Intergenic
1194655356 X:96566688-96566710 CCAGAGTATAAGCTCCTTGAAGG - Intergenic
1194665104 X:96668569-96668591 CTAGAGTGCAAACTTCTCAAGGG - Intergenic
1194670839 X:96730699-96730721 CTAGAGTGTAACCTCCTTAAAGG + Intronic
1194705688 X:97172830-97172852 CTAGAGTATACAGTCCTTAATGG - Intronic
1194744120 X:97609768-97609790 CTAAAGTGTAAGTTCCTTGATGG + Intergenic
1194795684 X:98209182-98209204 CTAGAATGTAAGCACCTCAAGGG + Intergenic
1194846940 X:98820845-98820867 CTGGACTGTGAGCTCCTTAAGGG + Intergenic
1194956210 X:100183816-100183838 TTAGAATGTAAGCTCCTTCATGG + Intergenic
1195655660 X:107329264-107329286 CTAGACTGTATGCTCCTTAAGGG + Intergenic
1195761562 X:108251644-108251666 CTATAATGTAAGCTACTTAAGGG - Intronic
1195787020 X:108537022-108537044 CTAGACTGGAAGTTCCTTAAAGG + Intronic
1195915494 X:109931193-109931215 ATAGAATGTAAGCTCCCTAAGGG - Intergenic
1195952785 X:110293958-110293980 CTAGAGTATAAACTTCTTAAGGG + Intronic
1196032340 X:111103975-111103997 CTAGATTGTAAGCTCTTCAAGGG + Intronic
1196105193 X:111887842-111887864 CTAGAATGTAAGCTCCATGAAGG - Intronic
1196130704 X:112152413-112152435 CTAGACTGTAACCTCTATAATGG + Intergenic
1196353411 X:114759965-114759987 CTAGATAGTAAACTCCTTGAAGG - Intronic
1196396570 X:115269164-115269186 CTGGAATGTAAGCTCCATAAGGG + Intergenic
1196706520 X:118722093-118722115 CTAGAATGTAAGCTCCATCAGGG - Intergenic
1196790016 X:119456194-119456216 CTAGAGTGTAAGCTCCTTGAAGG - Intergenic
1196798612 X:119522590-119522612 CTAGAATGTAAACACCTTGAAGG - Intergenic
1196891324 X:120293533-120293555 CTATATTGTAATCTCCTAAAAGG + Intronic
1197014766 X:121610087-121610109 CTAGATTACAAACTCCTTAAAGG - Intergenic
1197129690 X:122990829-122990851 CTAGAATGTAAGCTCCATGAGGG - Intergenic
1197228864 X:123981784-123981806 CTAGACTGTAAATTCCATAAGGG - Intronic
1197238173 X:124091725-124091747 CTAGACTGTGAGCTCCTCAAGGG + Intronic
1197238295 X:124093422-124093444 GTAGACTGTAAGCTCCTTGAGGG + Intronic
1197296521 X:124725250-124725272 CTAGATTGTAAGCTCATTAAAGG + Intronic
1197702047 X:129606882-129606904 CTAGACTGTGTCCTCCTTCAAGG + Intergenic
1197853984 X:130895094-130895116 TTAGACTGTGAGCTCCTTAAGGG + Intronic
1197854357 X:130899427-130899449 CTAGACTGTGAACTCCTTGAGGG - Intronic
1197865656 X:131014133-131014155 CTAGATTATAAGTTCCTTAAGGG - Intergenic
1198176425 X:134160046-134160068 CTAGAATGTAAGCTTCATAAGGG - Intergenic
1198210507 X:134511682-134511704 TTAGAGTGTTAGCCCCTTAAAGG + Intronic
1198250735 X:134877132-134877154 CTAGATTGTAAGCTCCTTCACGG - Intergenic
1198258531 X:134946200-134946222 CTAGAATGTGAGCTCCATAAGGG - Intergenic
1198282623 X:135156760-135156782 CTAGAATGTAAACTCCACAATGG - Exonic
1198284909 X:135179709-135179731 CTAGAATGTAAACTCCACAATGG - Intergenic
1198288336 X:135215762-135215784 CTAGAATGTAAACTCCACAATGG + Intergenic
1198523203 X:137473568-137473590 CTAGAATGTAAGCTCCCTGAGGG - Intergenic
1198548955 X:137724662-137724684 CTAGACTGTAAATTCCTTGATGG + Intergenic
1198633629 X:138671590-138671612 CTAGAATGTCAGCTCCTTGAGGG - Intronic
1198690631 X:139280379-139280401 CTAGATTGTAGACTCCTTGAAGG + Intergenic
1198708746 X:139478369-139478391 CTAGGGTATAACCTCCCTTAGGG + Intergenic
1199062898 X:143379849-143379871 CTAGATTGTAACTTCCTTAAGGG + Intergenic
1199246640 X:145612753-145612775 CTAGATTCTAAATTCCTTAAGGG + Intergenic
1199455862 X:148028024-148028046 CTAGAATGTAAACTCTATAAGGG - Intergenic
1199536655 X:148910405-148910427 CTAGACTCTAAACTCCTCAAGGG - Intronic
1199678983 X:150212519-150212541 CTAGAATGTCAGCTCCTTGAAGG + Intergenic