ID: 1194672172

View in Genome Browser
Species Human (GRCh38)
Location X:96747265-96747287
Sequence TGCAACCTGAACCTCCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194672172_1194672175 5 Left 1194672172 X:96747265-96747287 CCCAAGTGGAGGTTCAGGTTGCA 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1194672175 X:96747293-96747315 AACATATAGATACGTCAATAAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1194672172_1194672176 23 Left 1194672172 X:96747265-96747287 CCCAAGTGGAGGTTCAGGTTGCA 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1194672176 X:96747311-96747333 TAAGGACTGTGTTCTGATATAGG 0: 1
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194672172 Original CRISPR TGCAACCTGAACCTCCACTT GGG (reversed) Intronic
900185859 1:1332936-1332958 TACAACCTGACCTTCCACGTGGG + Exonic
903120048 1:21210243-21210265 TGCAAGCTGCACTGCCACTTGGG + Intergenic
903671049 1:25035471-25035493 TGAAACCTGACCCTCCTCCTTGG - Intergenic
903725508 1:25440321-25440343 TGCAGCCTCAACCTCAACCTGGG - Intronic
904143524 1:28371675-28371697 TGCAGCCTGGACCTCCTCCTGGG + Intronic
904194475 1:28774781-28774803 TGCAACCTCCACCTCCTCCTGGG - Intergenic
904398032 1:30236166-30236188 TGGAACCTTAATCTCCATTTTGG - Intergenic
904419796 1:30384343-30384365 AGCACCCTGAACCCCCACTGGGG + Intergenic
905612192 1:39363686-39363708 TGTAACCTCAACCTCCACTTGGG + Intronic
905707368 1:40071163-40071185 TGCTACCTTGAGCTCCACTTAGG - Intronic
906178551 1:43798090-43798112 TGCAGCCTGAACTTTCAGTTGGG - Intronic
908730238 1:67218841-67218863 TGCAACCTCCACCTCCTCCTGGG - Intronic
909172634 1:72315612-72315634 TGCAACCTGCTCTACCACTTGGG - Intergenic
912353462 1:109036454-109036476 TGCAACCTTCACCTCCTCCTGGG - Intronic
912895264 1:113579826-113579848 TCAAACCTGTTCCTCCACTTAGG - Intronic
914505472 1:148285397-148285419 TGCAGCCGGTCCCTCCACTTGGG - Intergenic
914507090 1:148298754-148298776 TGCAGCCGGTCCCTCCACTTGGG + Intergenic
916335198 1:163663163-163663185 TGCAAGCAGAACCTCAGCTTTGG + Intergenic
918454403 1:184693271-184693293 TGCAATATGAACCTCCCATTGGG - Exonic
923104686 1:230844920-230844942 GGCAACCTAAACCTCCTCTTTGG + Intronic
1063826405 10:9903500-9903522 TGCAACCTCCACCTCCTCCTAGG + Intergenic
1064905757 10:20343836-20343858 TGGAACCAGAAGATCCACTTGGG + Intergenic
1065198354 10:23288662-23288684 TGAAATCTGAACCTAAACTTAGG + Intronic
1067133837 10:43590897-43590919 TTCAACCTAAACATCCCCTTAGG - Intergenic
1070243791 10:74710872-74710894 TGTAAACTGAACAACCACTTTGG + Intergenic
1071808870 10:89156109-89156131 TCCAACCTGGACCTCTTCTTTGG - Intergenic
1076697488 10:132253991-132254013 TTTAACCTGAAACTCCACTGAGG - Intronic
1077126866 11:943641-943663 TGCCACCTGCATCTCCAGTTGGG - Intronic
1077126906 11:943879-943901 TGCCACCTGCATCTCCAGTTGGG - Intronic
1077546201 11:3171114-3171136 TGGGTCCTGAACCTCCACGTTGG + Intergenic
1078575939 11:12502841-12502863 TACAACCTGTACATCCACATAGG + Intronic
1079031305 11:16988283-16988305 TGCAATCTAAACCTCTCCTTAGG + Intronic
1079310002 11:19356734-19356756 TGAAACCTTAACCCCCACTGTGG + Intronic
1080182624 11:29443033-29443055 TGCAACTTGAGCTGCCACTTTGG - Intergenic
1084647423 11:70466585-70466607 TCCAACCTGTACCGCCTCTTGGG + Intergenic
1085696342 11:78708037-78708059 TGCCACCTGAACTTCCTCTTTGG - Intronic
1088153834 11:106780507-106780529 TGCTAACAGAACCTCCACGTCGG + Intronic
1089285755 11:117407016-117407038 TGCAACCTCCACCTCCTCCTGGG - Intronic
1091217343 11:133910631-133910653 TGCCAGCTGAACGTGCACTTGGG - Intronic
1093631352 12:21413315-21413337 TGCAACCTCCACCTCCTCCTGGG + Intronic
1095922282 12:47543354-47543376 TGCACCCAGAAGCTTCACTTGGG - Intergenic
1096452687 12:51757199-51757221 TGCATCCTGCATCTCCAGTTAGG - Intronic
1098469570 12:70827794-70827816 TGCAACCTCCACCTCCTCCTGGG + Intronic
1099378978 12:81932922-81932944 TGCAAAATGTACATCCACTTTGG - Intergenic
1099689755 12:85937862-85937884 TGCAAGCTGCTCTTCCACTTGGG + Intergenic
1100231920 12:92617679-92617701 TGCAAGCTGCCCCTCCACTTGGG + Intergenic
1109092897 13:58071164-58071186 TGCAGCCTCACCCTCCTCTTAGG + Intergenic
1112012545 13:95304022-95304044 TCCCACCTGAACCTCCAGCTGGG - Intergenic
1112262056 13:97886079-97886101 GGCAACTGGAAACTCCACTTAGG - Intergenic
1112526035 13:100148170-100148192 TGCCACCTTAGCCTCCACTTGGG + Intronic
1114775493 14:25476108-25476130 AACAACCTGAACCTAAACTTTGG - Intergenic
1115742559 14:36403781-36403803 TGTAAACTGTAGCTCCACTTTGG + Intergenic
1115970020 14:38934366-38934388 TGCAACCTCCACCTCCACCTTGG - Intergenic
1116487696 14:45470648-45470670 TGTAACCTGAAAATCCACCTAGG - Intergenic
1119260164 14:73233425-73233447 TGCCATCTGAACTTCCACCTGGG + Intergenic
1119745284 14:77039495-77039517 TTGAACCAAAACCTCCACTTTGG + Intergenic
1120082048 14:80227705-80227727 TGCAAGCTGCTCTTCCACTTGGG - Intronic
1120780852 14:88484120-88484142 TGCAACCTCCACCCCCACCTTGG + Intronic
1128320690 15:66691786-66691808 TGCAGCCTGAAGCTACAATTTGG + Intergenic
1137023310 16:35451428-35451450 TGCCACCTGAACCACAACCTGGG - Intergenic
1141312838 16:82931953-82931975 TGCTTTCTGAACATCCACTTAGG - Intronic
1141547371 16:84780036-84780058 TGGAAGCTGAACCACCACTCAGG + Intergenic
1146236664 17:31172249-31172271 TGCAACCTCAACCTCTTCCTGGG - Intronic
1147018181 17:37509394-37509416 TGCAACCTCCACCTCCTCCTGGG + Intronic
1149656479 17:58311971-58311993 TGGGAGCTGAGCCTCCACTTGGG + Exonic
1155237043 18:23830920-23830942 AGCAACCTCAAACTCCATTTCGG + Intronic
1155294553 18:24372986-24373008 TGCAACCTCCACCTCCTCTTGGG - Intronic
1157998529 18:52588302-52588324 TGCAACCTGCTCTGCCACTTGGG - Intronic
1159544678 18:69824417-69824439 TGCAGCCTCAACCTCCTCCTGGG + Intronic
1162598054 19:11644646-11644668 TGCAACCTTCACCTCCTCCTGGG + Intergenic
1162761010 19:12888058-12888080 TACAACAGGAACCTCCACTCTGG + Intergenic
1164235610 19:23330510-23330532 TGTAACCTGAACATCCCTTTGGG + Intronic
1165321052 19:35085344-35085366 TGCAGCCTCCACCTCCACCTGGG - Intergenic
1165410072 19:35654427-35654449 TGCAACCTCTACCTCCTCCTGGG - Intronic
1166310686 19:41960770-41960792 TGCAACCTCCACCTCCTCCTGGG + Intergenic
927182183 2:20454581-20454603 TGCACCCTCAACCTCAACCTGGG + Intergenic
927984152 2:27395731-27395753 TGCCACCTCAGCCTCCACATAGG - Intronic
929495128 2:42434378-42434400 TGCAACCTCAACCTCCTCCTGGG - Intergenic
930910127 2:56620721-56620743 TGCAAGCTGATCTGCCACTTGGG + Intergenic
932634685 2:73378029-73378051 TGTCACCAGAACCTGCACTTTGG + Intergenic
933687844 2:85157634-85157656 TGCATTCTGAAACTCCAGTTTGG + Intronic
934138715 2:89023193-89023215 TCCAACCTGAACCCACATTTGGG - Intergenic
934317852 2:91942008-91942030 TGCCACCAGAACCTTCTCTTTGG + Intergenic
936158113 2:110063278-110063300 TGCAACCTCCACCTCCTCCTGGG + Intergenic
936186578 2:110308168-110308190 TGCAACCTCCACCTCCTCCTGGG - Intergenic
936912470 2:117607035-117607057 TGAGACCTGAACATCCATTTGGG - Intergenic
937062450 2:118990739-118990761 TGGAGTCTTAACCTCCACTTTGG - Intronic
940786529 2:157987608-157987630 TGCAGCCTCGACCTCCTCTTGGG - Intronic
941445800 2:165597929-165597951 TGCAACCTTCACCAGCACTTAGG - Intronic
941872420 2:170399813-170399835 TGCAACCTGAACCTCTTATCTGG - Intronic
942929299 2:181470525-181470547 TGAAACCAGTACCTCCACTTGGG - Intronic
945155410 2:206832564-206832586 TGAAACCAGAAACTTCACTTAGG + Intergenic
945224286 2:207517260-207517282 TCCAACCTGACCTTCCTCTTGGG + Intergenic
945464050 2:210146013-210146035 TGCAACCACATCCTCCTCTTTGG + Intronic
946334220 2:219026887-219026909 GGCAACCAAAGCCTCCACTTTGG + Intronic
947036072 2:225857407-225857429 TGAAACCTGAACATACTCTTTGG - Intergenic
948396847 2:237650842-237650864 TCAAACCTCAACATCCACTTTGG - Intronic
1169078801 20:2781448-2781470 TGCCACCTAAATCTCCTCTTTGG - Intergenic
1169375027 20:5059686-5059708 TGCAGCCTCAACCCCCACTCAGG + Intergenic
1172289750 20:33767454-33767476 TGCAACCTCCACCTCCATGTTGG + Intronic
1172551748 20:35805938-35805960 TGCAACCTCCACCTCCTCCTGGG + Intronic
1172671572 20:36637965-36637987 TGCAACCTCCACCTCCTCCTGGG + Intronic
1173584960 20:44175597-44175619 TGCAACCTGACCCTGCTCCTGGG - Intronic
1174113765 20:48213518-48213540 TGCAACCAGAGGCTCCACTCTGG - Intergenic
1175459666 20:59142973-59142995 TGCAACCTCGACCACCACCTAGG + Intergenic
1176070033 20:63221454-63221476 TGCTCCCTGAGCCTCCACCTTGG - Intergenic
1176124596 20:63469836-63469858 TGCAGCCCCCACCTCCACTTGGG - Intronic
1177913148 21:27056034-27056056 TGCAAGCTGCTCTTCCACTTGGG + Intergenic
1179379786 21:40887788-40887810 TGCCACCTTAACCTACATTTTGG - Intergenic
1182621959 22:31623276-31623298 TCCATCCTGAACCACCCCTTTGG + Intronic
1184476445 22:44724654-44724676 TGAGATCTGAACCTCCACCTTGG - Intronic
950431843 3:12955398-12955420 GGCAACCTGCACTTTCACTTGGG + Intronic
957257004 3:77850352-77850374 TGCAACCTCCACCTCCACCTAGG + Intergenic
957555825 3:81763260-81763282 TGCAATCTGAAGCACCACATCGG - Intergenic
960021466 3:112959338-112959360 TTCAAACTGAAACTCAACTTGGG + Intronic
963086295 3:141439650-141439672 AGCATCCTGAACCTCCCTTTAGG - Intronic
967253962 3:187570969-187570991 TACAAACTAATCCTCCACTTGGG - Intergenic
969352761 4:6607280-6607302 TGCAGCCTCAACCTCCTCTGGGG + Intronic
971482850 4:27129482-27129504 AGCAACCTGCACCTCCTCTTGGG - Intergenic
971887158 4:32465096-32465118 TGCAGTCTCAACCTCCTCTTGGG - Intergenic
974466520 4:62263738-62263760 TGCAACCTGGAGCTATACTTGGG + Intergenic
974509040 4:62813330-62813352 TGCAACCTAAATCTAAACTTTGG + Intergenic
974727188 4:65812356-65812378 TGCAAGCTGATCTGCCACTTGGG + Intergenic
982225945 4:153166622-153166644 TGCAACCTCACCCTCAACCTGGG + Intronic
982835515 4:160116464-160116486 TGCAAGCTGCTCTTCCACTTGGG + Intergenic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
984965863 4:185139144-185139166 TACAACCAGAACCCCCTCTTGGG + Intergenic
989382136 5:40820166-40820188 CTCAACCTCAACCTCTACTTAGG + Intergenic
990864644 5:60367370-60367392 TGCAACCTCCACCTCCTCCTGGG - Intronic
991425924 5:66491777-66491799 TGCTACCTCAGCCTCCACCTTGG - Intergenic
991911555 5:71568064-71568086 TGCAGCCTCAACCTCCTCCTGGG - Intergenic
996487111 5:124049432-124049454 AGCAACCTGGCCCTCAACTTTGG - Intergenic
997468140 5:134101862-134101884 TGCAGCCTGACCCTCCCATTAGG + Intergenic
997622163 5:135305947-135305969 TGCAACCTGAACAGCCAGCTGGG - Intronic
999355278 5:150923062-150923084 TGCAACCTCCACCTCCTCCTGGG - Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1002448291 5:179303288-179303310 TGGAACCTGAACCTTCTCCTAGG - Intronic
1002873936 6:1193733-1193755 TGCAACCAGTATCTCCACTTCGG - Intergenic
1005584709 6:27265067-27265089 TGTAAAGTGAACCACCACTTTGG - Intergenic
1006526831 6:34613133-34613155 TGCAACCTCCACCTCCTCTTAGG - Intronic
1006567473 6:34972682-34972704 TCCAAGCTGTACCTCCTCTTTGG + Intronic
1006587923 6:35130560-35130582 TGCCATCTGAACATCCTCTTTGG - Intronic
1006638634 6:35477259-35477281 TGGCACCTGCACCTCCACTCAGG - Intronic
1009569760 6:65369612-65369634 TGCAACCTAAACTTCCTCTAAGG + Intronic
1009759914 6:67992035-67992057 TGCAGCCTGAAACTCCTCTTAGG - Intergenic
1011510557 6:88095601-88095623 TGCAACCTGTTCCGGCACTTGGG + Intergenic
1015423147 6:133034616-133034638 TTCAACCTGAACCACCACCCAGG - Intergenic
1016305371 6:142678572-142678594 TGGAAGCTGAAACTCCTCTTGGG - Intergenic
1016839023 6:148507314-148507336 TAAAACATGACCCTCCACTTGGG + Intronic
1024331363 7:48158892-48158914 TGCAACCTAAACTTGCATTTGGG - Intergenic
1024776199 7:52789302-52789324 AGCACCCTGAACCTGCACCTGGG + Intergenic
1025154881 7:56595802-56595824 TGCAACCTGAACATCCCTTTGGG - Intergenic
1025762996 7:64412282-64412304 TGCAACCTGAACATCCCTTTGGG + Intergenic
1030261486 7:107569501-107569523 TGAAACCTATACCTCAACTTGGG + Intronic
1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG + Intronic
1038415272 8:27390295-27390317 AGCCACCTGATCCTGCACTTAGG + Intronic
1039139752 8:34373323-34373345 TGTAACATGATCCTCCCCTTGGG - Intergenic
1040415784 8:47194221-47194243 TTCAGCCTGAACTGCCACTTTGG + Intergenic
1040689009 8:49911655-49911677 TGCGACCTGGACCTGCGCTTAGG + Exonic
1041072627 8:54140334-54140356 TGCAACCTTCACCTCCACCTTGG + Intronic
1046775548 8:118159792-118159814 TGCAACCTCCACCTCCCCTCTGG + Intergenic
1046877598 8:119273537-119273559 TGCAAAATGGACATCCACTTTGG + Intergenic
1047453602 8:124989135-124989157 TGCAAGCTGCACTGCCACTTGGG + Intergenic
1049438290 8:142597711-142597733 TGCAGCCTGAACCACCTCCTGGG - Intergenic
1049989450 9:977509-977531 TGCCAGCTGCAGCTCCACTTGGG + Intronic
1051522373 9:18003527-18003549 TGCAACATGAATCAGCACTTTGG + Intergenic
1058703325 9:107619053-107619075 TGCAGCCTCGACCTCCACCTGGG + Intergenic
1059149986 9:111940621-111940643 TGCAACCTCCACCTCCTCCTGGG - Intergenic
1060675846 9:125513836-125513858 TGCACCCTGCACCCCTACTTTGG - Intronic
1062378288 9:136274827-136274849 TGCAACCTGCATTTCCACATTGG + Intergenic
1062493240 9:136818962-136818984 TGCAACCTGTTTCTACACTTTGG - Intronic
1203486177 Un_GL000224v1:57461-57483 TGCAACCTCCACCTCCTCTCTGG - Intergenic
1186418955 X:9408414-9408436 TGGAACCTGGACCTTCACTCAGG + Intergenic
1188509532 X:30920472-30920494 AGCATCCTCAACCTCCACTGGGG + Intronic
1190157996 X:48009059-48009081 GACAACCTCAACCTCCATTTGGG - Intronic
1190173767 X:48131943-48131965 GACAACCTCAACCTCCATTTGGG - Intronic
1192448303 X:71226570-71226592 TGCAGCCTCAACCTCCTCCTGGG - Intergenic
1192950325 X:76009769-76009791 TGCAGCCTGCCCCTCCCCTTGGG + Intergenic
1193314401 X:80047199-80047221 TTCAAGCTGAACATCCCCTTAGG - Intergenic
1194672172 X:96747265-96747287 TGCAACCTGAACCTCCACTTGGG - Intronic
1195945268 X:110203571-110203593 CACAACCTGACCCTCCACTTGGG - Intronic
1196261912 X:113593294-113593316 TTCTACCTTCACCTCCACTTAGG + Intergenic
1198452240 X:136778563-136778585 TGCAACCTCCACCACCTCTTGGG + Intronic
1200978978 Y:9243994-9244016 TTCAAGCTAAACCTCCTCTTAGG - Intergenic
1201282434 Y:12353263-12353285 TGCAGCCTCCACCTCCACCTGGG - Intergenic