ID: 1194673933

View in Genome Browser
Species Human (GRCh38)
Location X:96770410-96770432
Sequence CGTAATATTACACTTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194673933 Original CRISPR CGTAATATTACACTTGTGTC AGG Intronic
902193432 1:14779967-14779989 GGTAACATTTCACTGGTGTCAGG + Intronic
904728768 1:32571871-32571893 CCTAATATTATATTTGTGGCCGG - Intronic
911004511 1:93204553-93204575 GATAATATTACACTTGACTCTGG - Intronic
919432333 1:197511442-197511464 CCTAATTTTATACTTGTCTCTGG - Intronic
1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG + Intergenic
1065770939 10:29077929-29077951 CGTACTATTACACTTGAGCCTGG - Intergenic
1066570105 10:36762306-36762328 CGTAATCTTGCACTGTTGTCCGG + Intergenic
1078630954 11:13003894-13003916 AGTTATAATACACTTGTGTTAGG - Intergenic
1085099086 11:73785388-73785410 GGTAACATTTGACTTGTGTCTGG + Intergenic
1090058561 11:123444262-123444284 CGTAATATTATGCTAGAGTCAGG + Intergenic
1092991579 12:13907516-13907538 AGCAATAGTACTCTTGTGTCTGG - Intronic
1101786537 12:107888669-107888691 TTTAATATTACACATGTGGCTGG + Intergenic
1105620087 13:22058320-22058342 GATAATATTACACTTCAGTCTGG - Intergenic
1111964771 13:94849528-94849550 CATAATATTTCACTGGTTTCAGG - Intergenic
1113163814 13:107414785-107414807 TGTAAAATTACAGTTGTGTGTGG + Intronic
1127993317 15:64136579-64136601 GGCAATCTTACACTTGTGGCTGG + Intronic
1131588883 15:93726893-93726915 CATATTATTGCAATTGTGTCTGG + Intergenic
1144098961 17:11927150-11927172 CAGGATATTAGACTTGTGTCAGG + Intronic
1149402442 17:56312268-56312290 CTTGATATTCCACATGTGTCTGG + Intronic
928363833 2:30686709-30686731 CGTAATTTTGCACCTGTGCCAGG - Intergenic
932378218 2:71257196-71257218 TTTAAAATTACTCTTGTGTCTGG - Intergenic
935036625 2:99382487-99382509 CATAATATTCCACTTGTAACGGG - Intronic
938397193 2:130960277-130960299 CGTAATGGTACACTTGTATAAGG - Intronic
942174542 2:173319285-173319307 CGTAATATTATGCTGGAGTCAGG + Intergenic
1184655371 22:45938877-45938899 CGTAATATTACACATATTTATGG - Intronic
954173875 3:48827648-48827670 AGTAATTTTACACTTGTGTATGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
971161286 4:24136690-24136712 TGTAATATTAGACCTGTCTCAGG + Intergenic
980308523 4:131097817-131097839 CTTAATATTACAGTTGTTTTTGG - Intergenic
980736727 4:136899916-136899938 TGTGATATTACACTAGAGTCAGG + Intergenic
980835411 4:138186060-138186082 CATAATATTGCATTTGTGTCGGG - Intronic
982516958 4:156365165-156365187 CGTAATTATAGACTTGAGTCTGG - Intergenic
989490644 5:42048395-42048417 CTGAATATTACACCTTTGTCAGG - Intergenic
995164204 5:109019055-109019077 AAAAATATTACACTTGTGCCTGG - Intronic
995370294 5:111410418-111410440 TGTAATAATCCCCTTGTGTCAGG - Intronic
997795192 5:136802678-136802700 AGGAATATTAAACTGGTGTCTGG + Intergenic
1006659336 6:35626327-35626349 TGTAATGTTACACTTTTTTCTGG + Intronic
1007499823 6:42288232-42288254 TGTAAAATTATACTTGTCTCTGG - Intronic
1010657647 6:78530652-78530674 CCTAATTTTATACATGTGTCTGG + Intergenic
1011699971 6:89947075-89947097 CGAAGTATTACACTGGCGTCTGG + Intronic
1012196968 6:96355056-96355078 CATTACATTACTCTTGTGTCTGG + Intergenic
1013412734 6:109896308-109896330 TGTAATATTACACCAGAGTCAGG + Intergenic
1013599313 6:111689667-111689689 TATAGTATTACTCTTGTGTCTGG - Intronic
1020961069 7:14802060-14802082 CGTAATATTACATATTAGTCAGG - Intronic
1046357157 8:113102513-113102535 CATAAAATTACATTTCTGTCAGG + Intronic
1047970912 8:130083666-130083688 AATAATAATACCCTTGTGTCAGG - Intronic
1048701464 8:137095337-137095359 CTGAATATTAGACTTTTGTCAGG - Intergenic
1056396109 9:86182655-86182677 CTTATTATTAGACTGGTGTCAGG - Intergenic
1185829719 X:3289110-3289132 TGCAATAGTAAACTTGTGTCAGG + Intergenic
1188701361 X:33268452-33268474 TTTAATATTAGACTTTTGTCAGG - Intronic
1194673933 X:96770410-96770432 CGTAATATTACACTTGTGTCAGG + Intronic