ID: 1194674563

View in Genome Browser
Species Human (GRCh38)
Location X:96778819-96778841
Sequence CAGGGTAAACATTGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194674560_1194674563 -10 Left 1194674560 X:96778806-96778828 CCATGATTAGATTCAGGGTAAAC 0: 1
1: 0
2: 1
3: 21
4: 146
Right 1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
1194674558_1194674563 -8 Left 1194674558 X:96778804-96778826 CCCCATGATTAGATTCAGGGTAA 0: 1
1: 7
2: 57
3: 190
4: 421
Right 1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
1194674559_1194674563 -9 Left 1194674559 X:96778805-96778827 CCCATGATTAGATTCAGGGTAAA 0: 1
1: 1
2: 6
3: 29
4: 181
Right 1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194674563 Original CRISPR CAGGGTAAACATTGTGGGCA AGG Intronic
901413099 1:9098734-9098756 CAGGGGAAGCTTTGGGGGCAAGG - Intergenic
901561243 1:10073107-10073129 CAGAGGAAACATTATAGGCAAGG - Intronic
906942284 1:50265707-50265729 CAGAGATAACATTGTGGGGAGGG + Intergenic
908241320 1:62191524-62191546 AAGGTTAAACATTATGGGCGGGG - Intergenic
910503220 1:87918593-87918615 CAGGGCAGACATTTTTGGCATGG - Intergenic
910995561 1:93100996-93101018 AAGGGAAGAAATTGTGGGCATGG + Intronic
915366489 1:155319784-155319806 CAAGGTAATCATCCTGGGCAGGG - Exonic
915592824 1:156880285-156880307 GAGGGGACACAGTGTGGGCACGG - Intronic
915785774 1:158609838-158609860 CAGGGTTAGCATTGGGGGAATGG + Intergenic
916552210 1:165859893-165859915 CAGGGTGGACAAGGTGGGCAGGG - Intronic
917045612 1:170856679-170856701 CAGGGTATTCATTTTTGGCAAGG - Intergenic
920154831 1:203940051-203940073 CAGTTTGAAAATTGTGGGCAAGG + Intergenic
920340585 1:205272917-205272939 CAGGGAAGACACTGGGGGCACGG - Exonic
1063036282 10:2289638-2289660 CAAGGTCAACTTGGTGGGCACGG + Intergenic
1069249348 10:66247655-66247677 CAGTGGAAACCTTATGGGCAGGG + Intronic
1070794758 10:79210096-79210118 CAGGCTAAGCCATGTGGGCAGGG + Intronic
1072916237 10:99538897-99538919 GAGGTGCAACATTGTGGGCAGGG - Intergenic
1073041504 10:100610265-100610287 CAGGCTAAATATTCTGGGCTGGG - Intergenic
1074562734 10:114548380-114548402 CATGGTAAAGAGTGTGGGCCTGG + Intronic
1077150813 11:1072374-1072396 CACGGTAAACATGTTGGGCGTGG + Intergenic
1078863506 11:15275401-15275423 CAAGGAGAACATTGTGGGCCTGG + Intergenic
1078901097 11:15643636-15643658 CAGGGTATATGTTGGGGGCAGGG - Intergenic
1079458209 11:20655112-20655134 CAGGGTAAAACGTGTGGTCAGGG - Exonic
1080360238 11:31505255-31505277 TATGGGAAACATTGTGGACATGG + Intronic
1080690078 11:34549130-34549152 CAGGGCACACAGTTTGGGCAGGG - Intergenic
1084275232 11:68047896-68047918 CAGGGTAAGCATCGTGTGCTGGG - Exonic
1085688560 11:78647510-78647532 CTGGGTAAGCAGTGTGGACAGGG + Intergenic
1085798374 11:79564587-79564609 TAGGTTAAACAATGTGGCCAAGG + Intergenic
1087027821 11:93668483-93668505 CAGGGCAAAAATTGTGAACATGG - Intronic
1087786518 11:102361043-102361065 CATGGGAGACATTGTGGCCAAGG + Intronic
1088192700 11:107243196-107243218 CAAGGGAAACATTATAGGCAGGG - Intergenic
1089157914 11:116416144-116416166 CAGGGCAGACTTTGTGGGGATGG - Intergenic
1091501622 12:1023211-1023233 CAAGGTAATAATTGTGGGAATGG + Intronic
1092819397 12:12339209-12339231 CATGCAAAGCATTGTGGGCAGGG - Intronic
1093259331 12:16916205-16916227 CAGTGGAAACATTATGGGCCAGG - Intergenic
1094255914 12:28425929-28425951 CAGGATGAACATTGTGTGAAAGG - Intronic
1094493831 12:30977319-30977341 CAGGGAAAGGAGTGTGGGCAGGG - Intronic
1096079366 12:48823463-48823485 CAAGGTATACTTTCTGGGCATGG + Exonic
1097722609 12:63039624-63039646 GAAGGTAAATTTTGTGGGCAAGG + Intergenic
1097807821 12:63985246-63985268 CAAGGGAAACATCATGGGCAAGG + Intronic
1098183890 12:67876635-67876657 CATGGTAAATGTTGTGGTCAAGG + Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099991150 12:89721694-89721716 CAGGGCAAACAATGTGGACCTGG - Intergenic
1101252243 12:102947992-102948014 CTGAGTAAAGATTGTGGGTAGGG - Intronic
1101441232 12:104705618-104705640 CAGGTTAAATAACGTGGGCAGGG + Intronic
1104807903 12:131601128-131601150 CAGGGAAGACAGTGTGTGCAGGG + Intergenic
1106114032 13:26801681-26801703 CAGGGTTGACCTGGTGGGCATGG + Intergenic
1106603054 13:31203493-31203515 CGGGACAAACATTGTGGGCTCGG + Intronic
1106639774 13:31571960-31571982 CAGGGTAAACATTTTAGGCCCGG + Intergenic
1112795830 13:103055604-103055626 CTGGGCAAACATGGTGAGCAGGG + Intronic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1115730906 14:36268729-36268751 CAGGTCAAACATTTAGGGCAGGG - Intergenic
1116859241 14:49980563-49980585 CAGAGTAAGCATGGTGGCCATGG - Intergenic
1117881059 14:60314110-60314132 CAGTCTAGACATTGTGGGCCAGG + Intergenic
1119318491 14:73714790-73714812 CAGGGTGCACAGTGTGGTCAGGG - Intergenic
1120115220 14:80608701-80608723 CAGGGTAAACAGGGTAGGCAGGG - Intronic
1124783070 15:32654576-32654598 AAGGATAAACCTTGTGGTCAAGG - Intronic
1125311436 15:38382876-38382898 GAGGGTAATTATTGAGGGCAGGG - Intergenic
1126687020 15:51257308-51257330 AAGTGTAAACCTTGTGGTCATGG + Intronic
1127028399 15:54833878-54833900 GAGCCTAAACATGGTGGGCAAGG + Intergenic
1127399447 15:58572004-58572026 CAAGGTGAACATTGAGGACAGGG - Intergenic
1127968199 15:63939551-63939573 CAGGTAAAGCATTGAGGGCAAGG + Intronic
1128394996 15:67215555-67215577 CAGGAAAAACATTTTGTGCAGGG - Intronic
1130338711 15:82980386-82980408 CAGGGTAAACATTTTAGGATTGG - Intronic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133147883 16:3803652-3803674 CAGGGTAAGAAATGTGGCCAAGG + Intronic
1133447678 16:5876141-5876163 CAAGGTAAAAATTGTGGGATAGG - Intergenic
1134021299 16:10923322-10923344 CAGGGTAACCAGGGTGGGCTTGG + Exonic
1134664817 16:16011289-16011311 CAGGGTGAACAGTGTGTCCAGGG + Intronic
1135864782 16:26091229-26091251 CATGGTAAACATTACAGGCAAGG - Intronic
1140244815 16:73238582-73238604 CAGAGAAGGCATTGTGGGCAAGG - Intergenic
1142667056 17:1469192-1469214 CGGGGTAAATATGGTAGGCAGGG + Intronic
1143074010 17:4324193-4324215 CAGTGTAAACATTTTGGGGGAGG - Intronic
1145263564 17:21368776-21368798 CAGGGTTTAGGTTGTGGGCAGGG + Intergenic
1146191658 17:30772941-30772963 CAGGTTAAACATTTTTGGCAGGG + Intronic
1146336829 17:31979608-31979630 CAGGTTAAATATTTTTGGCAGGG + Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147632740 17:41942645-41942667 CAGGGTCAGCAAGGTGGGCAAGG + Intronic
1148020859 17:44552541-44552563 CAGAGGGAACATTGTGTGCAAGG - Intergenic
1149042768 17:52210043-52210065 CAGGCAAAACAGTGTGTGCAGGG + Intergenic
1149107176 17:52983475-52983497 TAGGGTAAACATTGTCTACAAGG + Intergenic
1149591327 17:57831917-57831939 CAGGGCAGAAATGGTGGGCAGGG - Intergenic
1152023763 17:77795753-77795775 CAGAGTCAACATGGTGGGCAAGG + Intergenic
1152167188 17:78717303-78717325 CAGATTAACCTTTGTGGGCATGG - Intronic
1153461661 18:5341000-5341022 CAGGGGAAACATTTTTGGCAAGG + Intergenic
1155731267 18:29161451-29161473 CAGGGTGGAAAATGTGGGCAAGG + Intergenic
1156651820 18:39234557-39234579 CATGGTAAACATTATTGCCATGG - Intergenic
1156651822 18:39234575-39234597 CATGGTAAACATTATTGCCATGG - Intergenic
1161228910 19:3162770-3162792 CTGGGGAAACAGTGTGGGAAGGG - Intronic
1163213836 19:15861913-15861935 AAAGGTACACATTGTGGGCCAGG - Intergenic
1164514677 19:28923681-28923703 CAAGGTTCACATTGTGGACACGG + Intergenic
1165348954 19:35266474-35266496 CAGGGTACCCGTTGTAGGCAGGG - Exonic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
925203811 2:1990136-1990158 CAGGATAAACGGTGTGGTCAAGG + Intronic
925852335 2:8094661-8094683 CAGGGTAGACAGTGTGGGCTTGG - Intergenic
928033502 2:27800859-27800881 CATGGTCAACATTGTGTGCTGGG + Intronic
931272850 2:60717916-60717938 CAGAGAAAACTGTGTGGGCAAGG - Intergenic
932657506 2:73623212-73623234 CAAGGTAAACATGTTGTGCATGG + Intergenic
934844152 2:97651284-97651306 CAGGTTACGCATGGTGGGCAAGG + Intergenic
935777239 2:106484531-106484553 TTGGGAAAACATTGAGGGCATGG - Intergenic
937032164 2:118749926-118749948 CAGGGTAAGCAGGGTTGGCATGG - Intergenic
939291939 2:140207090-140207112 CAGAGTAAACAAACTGGGCATGG + Intergenic
941440842 2:165533505-165533527 CAGGGCACACAATGTGAGCATGG - Intronic
942396318 2:175553436-175553458 AAGAGGAAACATTTTGGGCATGG - Intergenic
944909269 2:204293349-204293371 CATGGTATACACAGTGGGCATGG + Intergenic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
948198889 2:236115244-236115266 CAGGGGAACCACTGTGGCCATGG + Intronic
1169648293 20:7839186-7839208 CAAGGTAAAGATTGTGGTAAGGG - Intergenic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1173070871 20:39763701-39763723 CATGGTGGACATTGTGGGAAGGG + Intergenic
1175190228 20:57206911-57206933 CAAGGTAAACATTCTTGGAATGG - Intronic
1179168334 21:38952851-38952873 CAGGGAACACCTTGTGGGGAAGG - Intergenic
1181161166 22:20960759-20960781 CAGAAGAAACAGTGTGGGCAAGG - Intergenic
1181689469 22:24550550-24550572 ATGGGGAAACAATGTGGGCAAGG - Intronic
1182531730 22:30964925-30964947 CACAGTAAACATTGTGTGAATGG - Intronic
1183543370 22:38442691-38442713 CAAGGCGAACAGTGTGGGCAGGG + Intronic
951388565 3:22073534-22073556 TAGGGTAAAAATTATTGGCAAGG + Intronic
951408145 3:22326531-22326553 CAGTATAAACATTCAGGGCAAGG + Intronic
962096452 3:132297569-132297591 CAGGGTAATTATTTTGGGCCAGG + Intergenic
964787322 3:160412331-160412353 CAGGGTAAAGATGGTGGAAAAGG + Exonic
972384379 4:38550489-38550511 CATGGAAAACATGGTAGGCATGG - Intergenic
973320961 4:48809800-48809822 CAGGGCAAACTTTCTGGGAAAGG - Intronic
973637089 4:52870403-52870425 CAGGGCAGACATAGCGGGCATGG - Intergenic
973783965 4:54317970-54317992 CAGGGTAAACAGTGTAGGACTGG + Intergenic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979004123 4:115266958-115266980 AATAGTAAACATTTTGGGCAGGG - Intergenic
979070369 4:116196286-116196308 CAAGTTAAACATTTTTGGCAGGG + Intergenic
980598240 4:134984728-134984750 CAGCATATACATTTTGGGCAGGG - Intergenic
980858118 4:138464699-138464721 CAGGGAAGACAATGTGGGCAGGG - Intergenic
983669988 4:170225844-170225866 CAGAGAAAACATTTTGGGAAAGG + Intergenic
984963336 4:185119486-185119508 AAGGGTAAACGTTTTGGGAAGGG - Intergenic
985711342 5:1431527-1431549 CAGGGTAGACAGTGTGGGTTGGG + Intronic
986643142 5:9891659-9891681 CAGAGGAAACACTGTGGGCTGGG - Intergenic
987093680 5:14529640-14529662 CAGGGACCACATTCTGGGCAGGG - Intronic
987137017 5:14909652-14909674 CAGAAAAAACATTGGGGGCAGGG - Intergenic
990196366 5:53321190-53321212 CAGGGTAATAATTTTGGGCTTGG - Intergenic
991168263 5:63588846-63588868 CAAGGTAAACATTGGGGAAATGG + Intergenic
994049643 5:95348033-95348055 TAGGGTAAACATTGGGAGAATGG + Intergenic
995749545 5:115439810-115439832 CAGCAGAAACATTGTGGGCTAGG - Intergenic
995969571 5:117952041-117952063 CAAGGGAAACATTGTGGGAAAGG - Intergenic
996150155 5:120024410-120024432 CAGGCAAAAGATTGTGTGCAGGG - Intergenic
996838620 5:127822096-127822118 CAGGGACAACATTCTGGGCTTGG + Intergenic
996992076 5:129647477-129647499 CAGGGTAAAGATTATGGGTAGGG - Intronic
997367787 5:133336872-133336894 CGGGGTACACAGTGTGGTCATGG - Intronic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1010986187 6:82427117-82427139 AAAGCTAAACATTGTGTGCAAGG + Intergenic
1014005239 6:116410299-116410321 CAGGGTAGTCTTTGTGGGAAGGG - Intronic
1014981397 6:127950200-127950222 GATGGTATACAATGTGGGCAGGG + Intergenic
1016723796 6:147335434-147335456 CAGGGTGAACAATTTGGACATGG + Intronic
1017295496 6:152789301-152789323 CAGATTAAACACTGTGGGCATGG + Intergenic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1018270838 6:162075882-162075904 AACCGTACACATTGTGGGCAGGG + Intronic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1019779025 7:2929026-2929048 CATGGTGAACAGTGTGGGCCTGG + Intronic
1021308084 7:19055823-19055845 TAGGGTAAAAATTTTGGGTAAGG - Intronic
1025622575 7:63187353-63187375 CAGGGTAAACTATGTTGGCCAGG - Intergenic
1030895901 7:115059487-115059509 CAGGCAAAACCTTGTGAGCAGGG - Intergenic
1033300797 7:140183441-140183463 CAGGTTAAACATTTTTGGCAAGG - Intergenic
1033420489 7:141200703-141200725 AGGGGTGAACAGTGTGGGCAAGG + Intronic
1036688301 8:10925904-10925926 CAGGGTAGAGGTTGTGGACAGGG + Intronic
1039566560 8:38556115-38556137 CACGGGACACAGTGTGGGCATGG + Intergenic
1041177484 8:55211595-55211617 CATGGGAAAGAATGTGGGCATGG + Intronic
1043718464 8:83512920-83512942 CAGGGTAGACAATGAGGGTACGG + Intergenic
1044464569 8:92488503-92488525 CTAGGCAAACATTGTGGGGAGGG + Intergenic
1046311738 8:112446204-112446226 CAGGGGACACATTGTAGTCAAGG - Intronic
1046381995 8:113463530-113463552 CAGGGAAAACATTCTGGAGAAGG + Intergenic
1047366109 8:124213060-124213082 CAGAGTAAACATTCTAGACAAGG + Intergenic
1047810540 8:128403848-128403870 CAGGGTAAGCCTTGTGGTGAAGG + Intergenic
1048095462 8:131287442-131287464 CACGTTAAACATTTTTGGCAAGG - Intergenic
1051547838 9:18296032-18296054 CAAGGTAAACATTTTTGGCCAGG - Intergenic
1053064153 9:35055264-35055286 CAGAGTCAACATTGCGGTCATGG - Intergenic
1055643594 9:78341842-78341864 CAGGTTAAGCATTTTTGGCAGGG + Intergenic
1055709450 9:79044318-79044340 CAGACTAAACATTCTTGGCAAGG + Intergenic
1057686969 9:97243487-97243509 CAGGGCAGTGATTGTGGGCATGG + Intergenic
1059973064 9:119687245-119687267 AAGAATAAACATTCTGGGCAGGG + Intergenic
1187583371 X:20633287-20633309 CAGGATAAAAATTGAGGGCAAGG - Intergenic
1189070871 X:37862483-37862505 CATGATAAACATACTGGGCAGGG + Intronic
1193165702 X:78277592-78277614 CAGTGAAAAAATTGTGGGCCTGG + Intronic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG + Intronic
1194742965 X:97597268-97597290 CAGGATAAACATTGAGTTCAGGG - Intronic
1195300055 X:103520501-103520523 CATGGTAACCATTCTGGCCAAGG + Intergenic
1195696803 X:107673495-107673517 GAGGTTAAACACTGTGGCCAAGG - Intergenic
1197069581 X:122279870-122279892 CATGGTAAATATTGTGCACAAGG + Intergenic
1197310191 X:124895197-124895219 CAGAGTAAGCCTTGTGGTCATGG + Intronic
1198941609 X:141963228-141963250 CAGGCAAGACATTGTGTGCAGGG + Intergenic
1198972866 X:142301138-142301160 CAGGGGAAACAGTGAAGGCAGGG - Intergenic
1199600872 X:149540442-149540464 GAGAGAAACCATTGTGGGCAGGG - Intronic
1200044870 X:153396091-153396113 CAGGGTCACCATCGTGGTCACGG + Intergenic