ID: 1194675050

View in Genome Browser
Species Human (GRCh38)
Location X:96784431-96784453
Sequence CCTAAAGTACTGAAGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194675050 Original CRISPR CCTAAAGTACTGAAGCTAAA GGG (reversed) Intronic
902971544 1:20056039-20056061 CCTAAATTCCAGAGGCTAAAAGG + Intronic
903572012 1:24313022-24313044 TCTAAAGTACAGAATGTAAAAGG + Intergenic
904874341 1:33642683-33642705 CCTAAGTAACTTAAGCTAAAAGG - Intronic
908962602 1:69716947-69716969 CAGAAAATACTAAAGCTAAAAGG + Intronic
909576347 1:77180893-77180915 CCAAAATCACTTAAGCTAAAGGG - Intronic
911550728 1:99276729-99276751 CCTAAAGTACTGATGCTAATGGG + Intronic
912577848 1:110691525-110691547 CCTAAAGAACTGAAGATCATGGG - Intergenic
916274434 1:162978510-162978532 CCTTAAGTAATGAAGCCACATGG - Intergenic
917411292 1:174762436-174762458 CCTAACGTAGTAAAGCTAAATGG - Intronic
917583483 1:176400041-176400063 CCTAAAAAACTGAAGATAAAAGG - Intergenic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
921080800 1:211737242-211737264 CCTCAAGGCCTGAAGCTGAAAGG - Intergenic
921167348 1:212516651-212516673 CCAAAAGTAGAGAAGCAAAAAGG + Intergenic
921464118 1:215464832-215464854 TCTTAAGTACAGAAGATAAATGG + Intergenic
921668573 1:217901720-217901742 CCTGAAATCATGAAGCTAAAGGG - Intergenic
922768499 1:228168886-228168908 CCAACAGAACTGAAGCTAGAGGG - Intronic
923581811 1:235224410-235224432 CCTAAAGAACAGTAGCAAAATGG - Intronic
923885850 1:238154657-238154679 CCTAAAATAATGAAATTAAAAGG + Intergenic
924137009 1:240978320-240978342 CCTAAAATACTCAACTTAAATGG + Intronic
1067391502 10:45867064-45867086 CCTTAAGAACTGAACCAAAATGG + Intergenic
1067403181 10:45996603-45996625 CCTTAAGAACTGAACCAAAATGG - Intronic
1067872295 10:49972268-49972290 CCTAAAGTGCCGAATGTAAAGGG - Intronic
1068322483 10:55437783-55437805 CATAAAGAACAGAAGATAAATGG + Intronic
1070138172 10:73714058-73714080 CCTAAAGTGCTGTATGTAAAGGG + Intergenic
1071580821 10:86768136-86768158 CCTCAATTACTGAACCTAAGAGG + Intronic
1072398519 10:95071214-95071236 GCTAAAGTACTGAATCTCCATGG - Intergenic
1074502371 10:114037912-114037934 CTTAAAGTACTGATGGTAATAGG - Intergenic
1076515069 10:131040680-131040702 CATAAAGTAAGGAAGCTTAAAGG - Intergenic
1081752690 11:45523312-45523334 CCTGCAGTGCTCAAGCTAAAGGG - Intergenic
1085101933 11:73808305-73808327 CCTGAAGTTCTAAACCTAAAAGG - Exonic
1087564003 11:99830377-99830399 CCAAAAGTACTGAAGACATAAGG - Intronic
1087819362 11:102694149-102694171 CTCTAAGCACTGAAGCTAAAAGG - Intronic
1089225885 11:116921366-116921388 CCTAAAGAACTGAGGCTATATGG - Intronic
1092975215 12:13738177-13738199 TCTGAAGTACTGCAGATAAAAGG - Intronic
1093213538 12:16335668-16335690 CCTAAAGTACTGTTGGTAAAGGG + Intergenic
1095499337 12:42819362-42819384 CCTAAAGTACTGAAATTACAGGG + Intergenic
1095675958 12:44918230-44918252 CCTAAAGTACAGATCCTATATGG + Intronic
1096360636 12:50982979-50983001 CCTAAAGAACTGAGTCTAGATGG + Intronic
1096971947 12:55673819-55673841 TCAACAGCACTGAAGCTAAAAGG + Intergenic
1097077887 12:56408697-56408719 CCTTAAGTCCTGAAGAGAAAAGG + Intergenic
1098532474 12:71556394-71556416 CCTGATGTCCTGAAGCTAAAAGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099482519 12:83186729-83186751 CATGAAGCACTGAAGCAAAATGG + Intergenic
1102839493 12:116103018-116103040 CCTAAAGTAATGAAAATATAGGG - Intronic
1104030249 12:125059911-125059933 CCCAAAATCATGAAGCTAAAGGG - Intergenic
1105709393 13:22992060-22992082 CCTCAACTACTGAACCTTAAAGG + Intergenic
1106620507 13:31366882-31366904 CCTTAAGTCCTGAAGAGAAAGGG - Intergenic
1110849634 13:80230738-80230760 AATGAAGTACTGAAGTTAAATGG + Intergenic
1111717227 13:91894910-91894932 ACTAGAGTACTGAAGCCAGAAGG + Intronic
1113478422 13:110602261-110602283 CCAAAATGACTAAAGCTAAAGGG + Intergenic
1114342654 14:21760943-21760965 CCAAAAGACCTGAAGCTGAAGGG + Intergenic
1114379767 14:22190194-22190216 CCATAGGTACTGAAGCCAAAGGG - Intergenic
1115807744 14:37071026-37071048 ACTAAAGTACAGCAGCAAAAGGG + Intronic
1117669332 14:58090617-58090639 CCTAAAGTACTGAGATTACAGGG - Intronic
1121290842 14:92773776-92773798 CCTAAAGTGCTGGGACTAAAGGG - Intergenic
1121956032 14:98214271-98214293 CCTAATGTCCTCAAGATAAAAGG + Intergenic
1123223892 14:106881876-106881898 CCAAAATCACTAAAGCTAAAGGG - Intergenic
1125074018 15:35591518-35591540 CCTAAAGTACTCCAGATGAAGGG - Intergenic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1126788779 15:52201761-52201783 CATAAAGTAGGGAGGCTAAAGGG + Intronic
1129426478 15:75467099-75467121 GCTAAATTGATGAAGCTAAAAGG + Exonic
1131565369 15:93480556-93480578 GTTAAAGGACTGAAGCTGAATGG - Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140384921 16:74527644-74527666 CCTAAATTCTTGAAGGTAAAAGG - Intronic
1141295278 16:82762413-82762435 TCTCAAGTGCTGTAGCTAAAGGG + Intronic
1147273719 17:39297148-39297170 ATTGAAGTACTGAATCTAAATGG - Exonic
1147805854 17:43130736-43130758 ATTAAAGAACTGAAGCTCAAAGG + Intergenic
1150544269 17:66137030-66137052 CCTAAAGAAATGAAGGTAAATGG + Intronic
1155056473 18:22188163-22188185 CATAAAGTGTTGAAGTTAAATGG + Intronic
1155125859 18:22874891-22874913 CAGAGAGAACTGAAGCTAAATGG + Intronic
1155391473 18:25342018-25342040 CCTAGAGTACAGAGGGTAAATGG + Intronic
1156273865 18:35562577-35562599 CCCAAAGTGCAGAATCTAAAAGG + Intergenic
1157444699 18:47736027-47736049 TCTAAGGTATTGAAGCTGAAAGG + Intergenic
1159405553 18:67997990-67998012 TCTAAATTAATGAAGCTTAAAGG + Intergenic
1162933781 19:13970413-13970435 CCCAAAGTGCTGGAACTAAAGGG - Intronic
930078550 2:47427910-47427932 GGTAAATTACTGAAGCTGAAAGG - Intronic
931669981 2:64638414-64638436 CCTAAAGAAATAAGGCTAAATGG + Intronic
934101694 2:88659496-88659518 CCTAAAGTACAGCAGCAAGAGGG - Intergenic
935567320 2:104622733-104622755 CCTAAAGTACTGAAATTCATAGG + Intergenic
937960408 2:127453815-127453837 CCTAAAGGGCTGAAACTCAATGG + Intronic
938613013 2:132968810-132968832 TCTAAAGAACTGTAGCTGAAGGG + Intronic
940155741 2:150654418-150654440 CTGAAAGTGCGGAAGCTAAAAGG + Intergenic
943624571 2:190184202-190184224 CATAAATTAGTGAAGCTGAATGG + Intronic
945669144 2:212781515-212781537 GCTAAATTACTGAAGCAAATTGG + Intergenic
945690703 2:213031623-213031645 CCTAAAATAAGGAAGCAAAATGG + Intronic
946315737 2:218910678-218910700 CCTAGCGCAATGAAGCTAAAAGG + Intergenic
946462456 2:219881222-219881244 CCCAAAGTACTGAGGTTACAGGG - Intergenic
946681967 2:222226793-222226815 CCTAAATTACTGATGCTATAAGG + Intronic
947179060 2:227396160-227396182 TCTCAAGGACTGAAGCAAAAGGG + Intergenic
1169373614 20:5047854-5047876 CCCAAAGTACTGAAATTATACGG - Intergenic
1173269316 20:41517465-41517487 CCTAAAGAACTGAAACTCTAGGG + Intronic
1177152319 21:17467385-17467407 CCTTAAGTATTGAAAATAAATGG + Intergenic
1178474537 21:32925880-32925902 CCCAAAGTACTGAAATTACAGGG - Intergenic
1181133055 22:20745417-20745439 CCATTAGTACTGATGCTAAAGGG - Intronic
1182111594 22:27727375-27727397 CCTAAGGCACTGAAGTTTAAAGG - Intergenic
949156087 3:829008-829030 CCTAAAGTATAAAAACTAAATGG + Intergenic
951506484 3:23451276-23451298 GCTAAATTAATGAATCTAAATGG - Intronic
951619357 3:24584084-24584106 CCTGAAGTACTTAAGCAAAGAGG + Intergenic
952449099 3:33414085-33414107 ACTAAAATACTAAAGATAAAAGG + Intronic
953447155 3:42978459-42978481 CCTCCAGTACTGAAACTAACAGG - Intronic
953626519 3:44576690-44576712 CCTTTAGATCTGAAGCTAAAAGG + Intronic
957947416 3:87082948-87082970 CCAAAAGCACTCAAGCTACACGG - Intergenic
961913324 3:130344321-130344343 CAAATAGTACTGAAGCCAAAAGG - Intergenic
963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG + Intergenic
963798052 3:149650757-149650779 CCCAAAATGCTGAAGCAAAAGGG + Intronic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
968383005 4:111041-111063 CCCAAAGTAACTAAGCTAAAGGG + Intergenic
968848562 4:3062094-3062116 CCCAAATCACTGAAGCTAAAGGG - Intergenic
970914102 4:21312170-21312192 CTTAAAGGACTGAAGACAAATGG + Intronic
971823618 4:31592266-31592288 ACTAAAATACTGAAGAGAAACGG + Intergenic
972036385 4:34527792-34527814 ACAAAAGAACTAAAGCTAAAAGG - Intergenic
974573178 4:63682542-63682564 CCGACAGTAGTGAAGCTATATGG - Intergenic
979541790 4:121892000-121892022 CCCCAGGTACTGAACCTAAAGGG + Intronic
983383828 4:167031860-167031882 CCTAAAGAACTGAATTTGAATGG - Intronic
984550460 4:181153131-181153153 CATAGATTACTGCAGCTAAATGG + Intergenic
986502002 5:8410484-8410506 CTTAAATTACTTAAACTAAATGG + Intergenic
986659330 5:10045045-10045067 CCTAAAGTTGTGAAGCTGATTGG + Intergenic
988773706 5:34456360-34456382 CCTCAAATACCTAAGCTAAAGGG - Intergenic
988970207 5:36459190-36459212 GCAAATGTAATGAAGCTAAATGG + Intergenic
989598173 5:43177335-43177357 CTTCAAGTACTGAAGCAAACTGG + Intronic
990857229 5:60282121-60282143 CCTAGTGTACAGAATCTAAAAGG + Intronic
993311841 5:86342605-86342627 TTTAATGTGCTGAAGCTAAATGG + Intergenic
994794844 5:104283154-104283176 CCTACACTACTGAAGACAAAGGG - Intergenic
995389417 5:111623937-111623959 CCTAAAGTCCTGCAGCCAGAAGG - Intergenic
996792165 5:127304752-127304774 CCTAAAGTTCTGGAGTTACAGGG + Intronic
996860595 5:128061475-128061497 CCTCAAGAACTGAACCTAAGAGG + Intergenic
996973609 5:129403301-129403323 CCTAAAGTACAGAAGAGAAATGG + Intergenic
998875312 5:146593211-146593233 CCTAATGTCCTACAGCTAAAAGG - Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999292249 5:150433747-150433769 CCTAAAGTATGGAAGTTACAGGG - Intergenic
1000087701 5:157902544-157902566 CCTAAGGTGCTGAAGTTGAAAGG - Intergenic
1000468008 5:161604119-161604141 CCTGATGTACTCAAGCAAAATGG + Intronic
1003139652 6:3459350-3459372 CCTCTAAAACTGAAGCTAAAAGG + Intergenic
1003468885 6:6409935-6409957 CCTACAGTACTGAAGAAAACTGG + Intergenic
1004025407 6:11813465-11813487 CCAAGAGTATTCAAGCTAAATGG + Intergenic
1006680043 6:35790435-35790457 CTTCAAGTACTGAACCTAAGAGG - Intronic
1008558542 6:52700106-52700128 CCTAAAGTCTTTCAGCTAAATGG + Intergenic
1008896080 6:56557122-56557144 CCCAAAGAACTAAAGCTATAAGG - Intronic
1014417262 6:121197352-121197374 CCTGAGGTACTGAAGGCAAAGGG + Intronic
1015739383 6:136437199-136437221 AATAAAGGAGTGAAGCTAAAGGG - Intronic
1016657325 6:146536303-146536325 TCTATAATACTGAAGATAAAAGG + Intergenic
1018654085 6:166016153-166016175 CATAAAAGACTGAAGATAAATGG + Intergenic
1022960283 7:35419475-35419497 ACTCACTTACTGAAGCTAAAAGG + Intergenic
1024736102 7:52306461-52306483 TCTAAACTATTGAAGCCAAAAGG - Intergenic
1027019408 7:74801251-74801273 CCTACAGTGCTGAAGCAAAAGGG - Intronic
1027068618 7:75144690-75144712 CCTACAGTGCTGAAGCAAAAGGG + Intronic
1027240389 7:76323969-76323991 CCTAAAGAATTGAAGTTGAATGG - Intergenic
1027756803 7:82224033-82224055 CCTAAAGTAATGAAAGTGAAGGG - Intronic
1030275305 7:107714506-107714528 CATAAACTACTGGAGCTAAAAGG - Intronic
1031212140 7:118843329-118843351 CCTAAAATATTTAATCTAAAAGG - Intergenic
1031746790 7:125508892-125508914 CATAAAGTACTGAAGAAAAAGGG + Intergenic
1033253529 7:139779430-139779452 CCTAGACTACTGTTGCTAAAAGG + Intronic
1033905827 7:146201001-146201023 CCTGAATTACTGAATCCAAAAGG + Intronic
1036012016 8:4736593-4736615 CATATTGTACTGGAGCTAAAAGG + Intronic
1041787651 8:61652902-61652924 ACTTAAGTACTGAATCCAAATGG - Intronic
1044681278 8:94780337-94780359 CCTAAAATATTAAAGCAAAAAGG - Exonic
1045896291 8:107221973-107221995 CCTAAATTCCTGGAGCAAAAGGG + Intergenic
1046831204 8:118748521-118748543 CCAAAAGTAATGAAGCCAAAAGG + Intergenic
1049555613 8:143279938-143279960 CCTAAAGCACTGGAGCTGCAGGG + Intergenic
1050197387 9:3100872-3100894 CCCAAAGTACTGGGACTAAAGGG + Intergenic
1050477156 9:6051919-6051941 CCTAAAGTAATGGTGTTAAAAGG - Intergenic
1050722442 9:8606012-8606034 CCTAAAGAACCTAAACTAAAAGG + Intronic
1053164871 9:35837231-35837253 ACTAAAGGACTAAGGCTAAAGGG - Intronic
1056258424 9:84824059-84824081 CTTAAACCACTGAAACTAAATGG - Intronic
1056920977 9:90789037-90789059 CCTGAGGCACTGAAGTTAAAGGG - Intergenic
1059790334 9:117635696-117635718 CCTTAAACACTGAAGCTATAAGG - Intergenic
1061522342 9:131126296-131126318 CCTAAAGTCAGGAACCTAAAGGG + Intronic
1186161166 X:6778567-6778589 CCTCAAGTACTGCATCAAAAGGG - Intergenic
1188691983 X:33140600-33140622 CATAGAGTGCTAAAGCTAAATGG - Intronic
1189107201 X:38249260-38249282 CCTAAAGGACAGAAGTTACATGG + Intronic
1190439035 X:50458349-50458371 TCTATAATACTGAAGATAAAAGG + Intronic
1192927609 X:75771973-75771995 CCTACAGTTCTACAGCTAAAAGG + Intergenic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1200360542 X:155601198-155601220 ACTAAAGTCCTTGAGCTAAAAGG + Intronic
1201492765 Y:14560537-14560559 CCTAAAGTACTGAGGCCAGTTGG - Intronic