ID: 1194675322

View in Genome Browser
Species Human (GRCh38)
Location X:96787305-96787327
Sequence TTAGTTCAAAATCCATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194675322_1194675323 4 Left 1194675322 X:96787305-96787327 CCAATAAATGGATTTTGAACTAA 0: 1
1: 0
2: 2
3: 24
4: 309
Right 1194675323 X:96787332-96787354 TTTTTGAAGTCTTCAAAGATAGG 0: 1
1: 0
2: 2
3: 45
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194675322 Original CRISPR TTAGTTCAAAATCCATTTAT TGG (reversed) Intronic
904401674 1:30260708-30260730 TAAGTTCAAAATGCATTTCAAGG - Intergenic
906301256 1:44683394-44683416 TCACTTCAAATTACATTTATAGG - Intronic
909685141 1:78339472-78339494 TCAGTTCTAAAGCCATTTGTGGG - Intronic
911749126 1:101476080-101476102 TTGGTGGAAAATGCATTTATTGG - Intergenic
914359021 1:146914272-146914294 ATAGGTGAAAATCTATTTATTGG - Intergenic
914494724 1:148185604-148185626 ATAGGTGAAAATCTATTTATTGG + Intergenic
917147498 1:171908153-171908175 TTATTTCACAACTCATTTATTGG + Intronic
917935675 1:179864513-179864535 TTAGTTCCAAAACAGTTTATAGG + Intronic
918939276 1:190970769-190970791 ATAGTTGAAAATTCATCTATTGG - Intergenic
919506155 1:198399728-198399750 TTAGTCCAAAATCAAAGTATTGG - Intergenic
919538155 1:198814099-198814121 TTATTTGCACATCCATTTATAGG + Intergenic
920895666 1:210047270-210047292 TTAATTCAATAAACATTTATTGG - Intronic
923441678 1:234026776-234026798 TTGGTTCAAAATGGTTTTATGGG + Intronic
923676212 1:236082742-236082764 TTTGTTTACATTCCATTTATTGG + Intergenic
924161474 1:241237422-241237444 TTATTTCAAACTCCAGCTATGGG + Intronic
924195959 1:241607119-241607141 TTAATTCAAAGAACATTTATTGG - Intronic
924210256 1:241757782-241757804 TTGCTTCAAAATCCATTGGTGGG - Intronic
924215659 1:241818988-241819010 TTGGTTTAGAATACATTTATTGG - Intergenic
1066385157 10:34935614-34935636 TTCGTTCAACATATATTTATGGG + Intergenic
1068331073 10:55569852-55569874 TTAGTTTAAAATAAATTTACTGG - Intronic
1068681730 10:59827224-59827246 TAATTTCAAAATCCAGTAATGGG - Intronic
1068696002 10:59968859-59968881 TTAGTCCAATAGACATTTATAGG + Intergenic
1071145744 10:82568718-82568740 TCAGTTCAAATTACGTTTATTGG + Intronic
1071208696 10:83313373-83313395 TTTGTTGAAAATACAATTATTGG + Intergenic
1073817307 10:107222209-107222231 TGAGTTCTTTATCCATTTATAGG + Intergenic
1075303079 10:121342724-121342746 TAAGATCATAATCCATTTCTGGG + Intergenic
1077239979 11:1505538-1505560 TTGCTTCAAAAGCCATTTTTGGG - Intergenic
1077828235 11:5833926-5833948 TAAGTTTAAGATACATTTATAGG + Intronic
1079195825 11:18326186-18326208 TTATATCAAAATTCATTTATGGG - Intronic
1079648400 11:22895686-22895708 TGATTTCAAGATCCATTTAAAGG - Intergenic
1080338503 11:31228605-31228627 TTAGATGAAAAGCCATTTCTTGG + Intronic
1080374201 11:31688401-31688423 TTAGTTCAAATTCAATTACTTGG - Intronic
1081414662 11:42800054-42800076 TTATTTGAAAATCCTCTTATAGG - Intergenic
1082065781 11:47899107-47899129 TAATTTCAAATTCCATTTGTGGG - Intergenic
1083020400 11:59501079-59501101 TTTGTCCAAAATCTATTTAATGG - Intergenic
1085273720 11:75285086-75285108 TTAATGCAGAATTCATTTATTGG - Intronic
1086109356 11:83182238-83182260 ATGATTCAAAATACATTTATGGG - Intronic
1088071297 11:105788832-105788854 TTATTTCAGGATCCATTTTTGGG - Intronic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1093241361 12:16680269-16680291 TTGGTTTAATTTCCATTTATGGG + Intergenic
1093258952 12:16910119-16910141 TTAGTTCAAAATTTAATAATTGG - Intergenic
1093283082 12:17220354-17220376 TAAGTACAAGATCCCTTTATAGG - Intergenic
1093625902 12:21347863-21347885 TTATTTTAAAATACATTAATTGG - Intronic
1094552035 12:31462068-31462090 TTAGGTGAAAATCTGTTTATAGG + Intronic
1096751343 12:53760837-53760859 TTACTTCAAAATCCATTTTCTGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098353900 12:69591680-69591702 TTATTACAAAATCAATTTAATGG - Intronic
1098490051 12:71064961-71064983 TTCTTTGAAAGTCCATTTATAGG - Intronic
1099551540 12:84051163-84051185 TTAGTTAAAGAACCATGTATGGG - Intergenic
1099967983 12:89471219-89471241 TTAGTTCAATATCAATACATAGG + Intronic
1100439910 12:94607125-94607147 TTACTTGCACATCCATTTATAGG + Intronic
1102175799 12:110873652-110873674 TAAGTTAAAATTCCATTTATAGG + Intronic
1102907284 12:116686635-116686657 TTTGTTCAAAAAACATTTGTTGG - Intergenic
1104302570 12:127578169-127578191 TGAGTCCAAAATCCATTTGCAGG + Intergenic
1105415771 13:20210293-20210315 TTAGTTCAACATCCACTTATTGG + Intergenic
1105549991 13:21384729-21384751 TTGGTAGAAATTCCATTTATTGG + Intronic
1106525691 13:30539518-30539540 TTACTCCAAAATTCATTTACTGG + Intronic
1107094181 13:36516881-36516903 TTTATTCAAAAAACATTTATGGG - Intergenic
1107349923 13:39503056-39503078 GTAATTGAAAATGCATTTATTGG - Intronic
1107444111 13:40454856-40454878 TTTCTTGAAAATCCATTTTTTGG + Intergenic
1108684975 13:52811349-52811371 TCAGTTCAACATACATTTATTGG - Intergenic
1109006583 13:56885340-56885362 TTAGTTCAACAAACATTTATTGG - Intergenic
1109035034 13:57246671-57246693 TTAATACAAAATCTATTTTTAGG + Intergenic
1109519439 13:63488936-63488958 TTAGATCATAATCCTTATATAGG - Intergenic
1109604519 13:64675073-64675095 TTAATACAAAACCCTTTTATGGG - Intergenic
1109899792 13:68752402-68752424 TTATTTCAAAAGCCATATTTGGG - Intergenic
1111366988 13:87260514-87260536 TAAGTACAAAATGTATTTATGGG + Intergenic
1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG + Intergenic
1113001287 13:105640925-105640947 TTATTTCTATATGCATTTATTGG + Intergenic
1114625928 14:24130336-24130358 CTAGTTCAAAATTCTTTTATAGG + Intronic
1115031364 14:28798879-28798901 TTAGGTCAGAATCCAGTTTTTGG + Intronic
1115083470 14:29485217-29485239 TTAATTCCACATCAATTTATTGG - Intergenic
1115417753 14:33156239-33156261 TTAGTTAAATTTCAATTTATTGG + Intronic
1116279446 14:42883901-42883923 AATGTTCAAAATACATTTATAGG + Intergenic
1116348363 14:43826684-43826706 TTAGTTTAAATCCCATTTGTTGG - Intergenic
1116603703 14:46962219-46962241 TGAGTTAAAAATCCATATAAAGG + Intronic
1116711883 14:48378577-48378599 TTAGTTCAAAATGGTGTTATGGG - Intergenic
1118508936 14:66448660-66448682 TCAGTTGAACATCCATTTAAAGG - Intergenic
1119499251 14:75109463-75109485 TTCATTCAAAAAACATTTATAGG + Intronic
1119954269 14:78778420-78778442 TTAGGCCAAAATACAATTATTGG + Intronic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125379257 15:39069983-39070005 GAAGTTCAAAATCAAGTTATGGG - Intergenic
1125583525 15:40804276-40804298 TTTCTTTAAAATCCAATTATGGG + Intronic
1127363223 15:58263271-58263293 TTATTTCATAATCCATGAATGGG + Intronic
1127511725 15:59648625-59648647 TTTGTTTTAAATCCTTTTATGGG - Intronic
1127699356 15:61482799-61482821 TTCATTCAAAAAACATTTATTGG + Intergenic
1128291755 15:66483421-66483443 CAAGTTCAAAATCCATTAACAGG + Intronic
1131611273 15:93966815-93966837 TTACTTGAAAATCCAATAATAGG - Intergenic
1133694383 16:8247650-8247672 TTGCATCAACATCCATTTATTGG - Intergenic
1134517281 16:14897275-14897297 TTAATACAGAATCCATTTCTTGG + Intronic
1135298964 16:21308629-21308651 TTTGTCAAAAATCCATTAATTGG + Intergenic
1135481697 16:22826053-22826075 TTAGTTCCACATGAATTTATTGG + Intronic
1137422122 16:48343993-48344015 TGACTTCACAAACCATTTATGGG + Intronic
1141881183 16:86860644-86860666 TTTGTTCTCAATCTATTTATGGG - Intergenic
1145851661 17:28104900-28104922 CTAGTTCTAAATCCATTTTATGG + Intronic
1147681781 17:42253396-42253418 TGAGTTCAATATGCTTTTATTGG - Intronic
1148726293 17:49793111-49793133 TAAGTTAAAAATGCATTTACAGG - Intronic
1149805493 17:59613557-59613579 TCAGCTTAAAATCCATTTATCGG - Intergenic
1154954936 18:21243572-21243594 TGAGTTCAAAAACCTTTTGTGGG - Intronic
1155588100 18:27391349-27391371 TGAGTTCAAAATCAGTTTAGAGG + Intergenic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1156091232 18:33472793-33472815 TTACTTGAAAATGCTTTTATAGG + Intergenic
1157461550 18:47901150-47901172 TTAGTTCAAAATAAAATTTTTGG + Intronic
1158359441 18:56655244-56655266 ATTGTACAAAATCAATTTATTGG - Intronic
1158767730 18:60475127-60475149 TTTTTCCAAAATCCAGTTATCGG + Intergenic
1159650988 18:70978540-70978562 TTATTTCAAACAGCATTTATTGG - Intergenic
1166116868 19:40661667-40661689 TTCATTCAAAAAACATTTATTGG - Intergenic
1167055503 19:47109112-47109134 TTAGTTAAAAATCAAATTAATGG - Intronic
927232764 2:20841615-20841637 TTAAATCAAAAGCCATTTTTAGG - Intergenic
928667632 2:33566489-33566511 TTAGAGAAAAATCCATATATTGG + Intergenic
928964664 2:36965594-36965616 TTCATTCAAAATGCATTAATTGG + Intronic
930293326 2:49523332-49523354 TTAATTGAAAATCCATTTATAGG + Intergenic
930314002 2:49775379-49775401 TCAGTTCAAAGACCATATATGGG + Intergenic
930515775 2:52406021-52406043 TTAGTTCAAAATCAATGGAGTGG + Intergenic
932089740 2:68796149-68796171 CTAGAACAAAATACATTTATTGG - Intronic
932443113 2:71750609-71750631 TTTGTTCAATAAGCATTTATTGG + Intergenic
932506496 2:72237489-72237511 TTTGTTCATAATCCATATGTTGG - Intronic
932880198 2:75494174-75494196 TTTGAACAAAATCCATGTATAGG - Intronic
932962106 2:76425384-76425406 TTAGTTCAAAATACTTTTTTTGG + Intergenic
933072448 2:77876881-77876903 TTAATCCAAAATACTTTTATGGG - Intergenic
933084504 2:78038823-78038845 TTAGTTCAAAAGCCATACATAGG + Intergenic
935374120 2:102377955-102377977 TGAGTTTAAAATTCAGTTATGGG - Intronic
935653892 2:105405244-105405266 TGATTCCAAAATCCATTTAAAGG + Intronic
936346069 2:111676239-111676261 TTAGATAAATATCCATTTCTTGG + Intergenic
937556463 2:123163976-123163998 TCAAATCAAAACCCATTTATTGG - Intergenic
938274980 2:130011169-130011191 TTAGTTCAAAGTTAATTTGTTGG + Intergenic
938694663 2:133824412-133824434 TTAGGTCATAACCCATTCATAGG - Intergenic
939215465 2:139232250-139232272 AGAATTCAAACTCCATTTATTGG + Intergenic
940040776 2:149358176-149358198 TATCTTCAAAATCCATTTATAGG - Intronic
940613781 2:156025148-156025170 TTGGTTCAAAATCTAACTATAGG + Intergenic
940715259 2:157215574-157215596 TTTGTTAATAATACATTTATAGG - Intergenic
941446426 2:165606018-165606040 TTTGTTAAAAAGCCATTTACTGG - Intronic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
942351062 2:175053369-175053391 TTAATTCAACATCTATTTTTTGG - Intergenic
942368748 2:175257789-175257811 TTGTTTAAAAATCCATATATAGG + Intergenic
943181710 2:184552276-184552298 TTACTTGAAAAACTATTTATAGG + Intergenic
943390391 2:187260072-187260094 TTAGTTAAAATTACATTGATTGG + Intergenic
943922344 2:193725157-193725179 TGAGGTGAAAATCCTTTTATTGG + Intergenic
944853850 2:203747332-203747354 TTAATTCAAAATACAAATATTGG - Intergenic
945316029 2:208371521-208371543 TTAGTTGAAAATACATTAACAGG - Intronic
945735255 2:213590788-213590810 TTAGTTGAATATCCACTAATAGG - Intronic
946494954 2:220186748-220186770 TGAGATCAAACTGCATTTATAGG + Intergenic
946542496 2:220700015-220700037 TATATTCAAAATACATTTATGGG + Intergenic
1169370647 20:5026846-5026868 TTTGTTGAAAATCAATTGATCGG + Intergenic
1173322835 20:42004522-42004544 TTTCTTCAAAATTAATTTATAGG + Intergenic
1173868851 20:46329589-46329611 TTAATTCAACCTCCATTTACAGG - Intergenic
1174099805 20:48118621-48118643 TTGGTCCCAAATTCATTTATAGG - Intergenic
1176727438 21:10451210-10451232 TTAGTTGATAAACCATTTAAGGG + Intergenic
1176956087 21:15105575-15105597 TTAGAGCACAATCCATTTGTTGG + Intergenic
1177878017 21:26658531-26658553 ATAGTTTAAAAGCCAGTTATTGG + Intergenic
1177975111 21:27838954-27838976 TTAAGTAAAAATCCATTTTTTGG - Intergenic
1178304493 21:31480097-31480119 TTAATTTAAAATCGATTGATTGG - Intronic
1178539622 21:33438495-33438517 TGTATTTAAAATCCATTTATAGG + Intronic
1178570219 21:33728894-33728916 TTCATTCAAAAACCAATTATGGG - Intronic
1179075488 21:38117021-38117043 TTTTTTCCAAATTCATTTATAGG + Intronic
1180286960 22:10755817-10755839 TTAGTTGATAAACCATTTAAGGG - Intergenic
1182556215 22:31129906-31129928 TTATCTTAAAATTCATTTATAGG + Intronic
1182788433 22:32928028-32928050 TAAGTTGAAAATGCATTTATTGG + Intronic
949142999 3:657995-658017 TTCATTCAAAAGACATTTATTGG + Intergenic
949299801 3:2570475-2570497 TTAGTTCAAAATACTTTTTAAGG - Intronic
951032629 3:17899638-17899660 TTATTTAAAAATTCATTCATTGG + Intronic
951218106 3:20042644-20042666 TTATTTTAAAATTTATTTATTGG + Intronic
951748968 3:26012649-26012671 TCAGTTCAGAATCCATTAACTGG + Intergenic
952023343 3:29049507-29049529 TTAGATTGAAATCCATTCATAGG + Intergenic
952572911 3:34738869-34738891 ATAGTTCAAAAACCACCTATCGG + Intergenic
953112996 3:39961642-39961664 TTATTTCAAAATCCAAATCTGGG - Intronic
953113243 3:39964966-39964988 TTATTTCAAAATCCAAATCTGGG - Intronic
953250389 3:41240866-41240888 TTAGTTCAAAGTCCAGTTGAAGG - Intronic
954504574 3:51056889-51056911 TTACATCAAAATCAATTTAATGG - Intronic
955952986 3:64260876-64260898 TGAGTTCCAAAGCCATTTGTGGG + Intronic
956087627 3:65629416-65629438 TTAGTTCAAAATCCTTATGCAGG - Intronic
956332100 3:68122699-68122721 TTATTTCAAGTTCTATTTATGGG - Intronic
957000636 3:74879545-74879567 TGAGTTCAAGATCCAGTTCTTGG - Intergenic
957809060 3:85193926-85193948 TTAATTTAAAGTCCATTTGTGGG + Intronic
958732022 3:97970047-97970069 TCAGTTTAAAATTCATTTAAGGG + Intronic
959586225 3:108027054-108027076 TTATTTCAAAACCCATTGGTGGG - Intergenic
960164235 3:114383854-114383876 TTAGTTGAAAATACATTTTGAGG + Intronic
961099256 3:124184800-124184822 TTAATTCAACAATCATTTATTGG - Intronic
963795860 3:149630214-149630236 TTATTGCAAAAGCAATTTATAGG - Intronic
964311435 3:155397543-155397565 TTATTTTAAAAACCATTTTTTGG + Intronic
964604387 3:158544121-158544143 TTAGGTCAAATTCAAGTTATTGG + Intronic
964628770 3:158785764-158785786 TTAATTGAAAATATATTTATGGG - Intronic
965966375 3:174495376-174495398 TCAGTTCAAAAAACATTTAATGG + Intronic
966366689 3:179195700-179195722 TGGATTCAAAATCCATTTATTGG + Intronic
967427394 3:189342929-189342951 ATATTTCAAAGTCCATTTAGTGG + Intergenic
967809837 3:193748590-193748612 TAAATTGAATATCCATTTATGGG - Intergenic
968857480 4:3137999-3138021 TTATTTAAAAATCCACTTCTAGG - Intronic
970250241 4:14107104-14107126 TTACTTAAAAATTCATTTTTAGG + Intergenic
970482835 4:16495004-16495026 TTAAATCAAACTTCATTTATTGG - Intergenic
972236492 4:37139719-37139741 TTAGTACAAAATCAATATAATGG - Intergenic
972979751 4:44681964-44681986 TCAGTTCAGAAAGCATTTATTGG - Intronic
973024335 4:45248443-45248465 TTACTTGCACATCCATTTATAGG + Intergenic
973078251 4:45958041-45958063 TTATATCAAAATCAATTTAAGGG + Intergenic
973241737 4:47963249-47963271 TCAATTTAAAATCCAGTTATTGG - Intronic
974856531 4:67467424-67467446 TTAGGTCAAAATTCATTTTTTGG - Intergenic
974938370 4:68434321-68434343 TATGTTCAAAATCATTTTATTGG - Intergenic
975080540 4:70274632-70274654 TTAGTCCAAATTCCTTTTATTGG - Intergenic
975873285 4:78806066-78806088 TTAGTTAAAAAGCAATTTGTAGG - Intronic
976309563 4:83597102-83597124 TTAATTCAAAAGTCATTTCTGGG + Intronic
978298893 4:107242692-107242714 TCAGTTCCAACTTCATTTATTGG + Intronic
979185480 4:117786260-117786282 TGGGTTAAAAATCCATCTATTGG - Intergenic
979200331 4:117970195-117970217 TTTGTACAAAATCCAAGTATCGG - Intergenic
979454893 4:120916086-120916108 TTAGTTCAAAATAAATAAATGGG + Intronic
979630524 4:122897203-122897225 TTATTTCAAAGTTCATTTAAAGG + Exonic
980689278 4:136273226-136273248 AAAGTTCAAAATAAATTTATGGG - Intergenic
981103374 4:140854949-140854971 TGAGTTCAAACCCCTTTTATGGG + Intergenic
981407665 4:144390464-144390486 GTAGTTCAATATCCATGTAATGG + Intergenic
981773884 4:148342362-148342384 TTAATTCAACAAACATTTATAGG + Intronic
982906092 4:161074388-161074410 ATAGTTCAATATTTATTTATAGG - Intergenic
984119133 4:175720814-175720836 TCAGTTCAAGATCCATCTTTTGG - Intronic
984368983 4:178836531-178836553 TTATATAAAAATCCATTTGTTGG + Intergenic
984674344 4:182529721-182529743 TTTGTTCAACACCAATTTATGGG + Intronic
985372427 4:189300217-189300239 TTAATTCAATATATATTTATTGG - Intergenic
987052748 5:14161702-14161724 TTTTTTCAAAATACATTTCTAGG - Intronic
987691545 5:21273228-21273250 TTTGTACAATGTCCATTTATAGG + Intergenic
989054140 5:37350500-37350522 TTAGATGAAAAGCCAGTTATGGG + Intronic
990894867 5:60687946-60687968 TTATGTAAAAATCCATTAATAGG - Intronic
991224311 5:64251714-64251736 TTAGTTCAAAAGTTTTTTATGGG - Intronic
991400147 5:66243544-66243566 TTACTTTAAAATCCACTTAAAGG - Intergenic
991748834 5:69776909-69776931 TTTGTACAATGTCCATTTATAGG - Intergenic
991800412 5:70356721-70356743 TTTGTACAATGTCCATTTATAGG - Intergenic
991828188 5:70653320-70653342 TTTGTACAATGTCCATTTATAGG + Intergenic
991892770 5:71356161-71356183 TTTGTACAATGTCCATTTATAGG - Intergenic
993129882 5:83882866-83882888 AATTTTCAAAATCCATTTATGGG - Intergenic
993851589 5:93016875-93016897 TTAATTCAAGAGACATTTATGGG - Intergenic
994079482 5:95691012-95691034 TTCTTTAAAAATTCATTTATTGG + Intronic
994524729 5:100890089-100890111 TGAGTTAAGATTCCATTTATAGG + Intronic
996046908 5:118883840-118883862 TTATTTCAAAATCTTTTTACAGG + Intronic
996613032 5:125406850-125406872 TTAGGTCAACAAACATTTATTGG + Intergenic
997350624 5:133228686-133228708 AAAGTTCAAAATCAATTTCTTGG + Intronic
998279271 5:140789147-140789169 GTAATTTAAAATACATTTATTGG + Intronic
998890095 5:146736671-146736693 TTAGTTCAAATACCAATTGTGGG - Intronic
999118137 5:149183006-149183028 TTAATTCAAAAGCCATTTGGAGG + Intronic
1000487749 5:161869490-161869512 TTATTTTAAAAACCATTAATTGG + Intronic
1000697597 5:164407104-164407126 TTATGTCAAAATCCATTTTTTGG - Intergenic
1000887554 5:166764446-166764468 TTTTTTCATAATCCATTTTTGGG + Intergenic
1004962607 6:20807885-20807907 GTACTTCAAAATCCATTTAAGGG + Intronic
1004974179 6:20946528-20946550 TAAGTTGAAAATGCATTTAAAGG - Intronic
1004974257 6:20947288-20947310 TAAGTTGAAAATGCATTTAAAGG + Intronic
1005363033 6:25050198-25050220 TTAGAACAATATCCATTTCTAGG - Intergenic
1007355311 6:41310744-41310766 CTAGTTCAAAATGTATTTGTGGG - Intergenic
1008331029 6:50244960-50244982 TTATTTTAAAACGCATTTATAGG - Intergenic
1010873908 6:81077495-81077517 TCAGTGCAAAATCTATATATAGG - Intergenic
1011448469 6:87468278-87468300 ATAGTTCCAAATTCATTGATTGG + Intronic
1011813626 6:91161786-91161808 TTAATTCAACACTCATTTATTGG - Intergenic
1012306225 6:97661375-97661397 GTAGATCAAAATCCATTCACAGG - Intergenic
1012454568 6:99390237-99390259 TTGGTTCAACATCTATTTAGTGG - Intronic
1012704474 6:102503687-102503709 CTACTTCCATATCCATTTATAGG + Intergenic
1012993909 6:105954259-105954281 TTGGATCAACATCCATTGATTGG + Intergenic
1013827126 6:114227363-114227385 TTTAATCAAAATCCTTTTATTGG - Intronic
1014478410 6:121904117-121904139 TAGGTTCTAAATACATTTATAGG - Intergenic
1015054167 6:128879283-128879305 TTAGGTAAAAATCTATTCATTGG - Intergenic
1015148510 6:130014592-130014614 TTACTTAAAAATCCCTTTCTCGG + Intronic
1017086769 6:150719976-150719998 TTAGTTTAAAATCACTTAATAGG + Intronic
1017573772 6:155778760-155778782 TCAGTTAAAGATGCATTTATTGG + Intergenic
1018211263 6:161484276-161484298 TTGGTTCAAAAGCCAGTTATAGG - Intronic
1020761997 7:12279259-12279281 TTAGTTTAAAAACTATTTAAAGG + Intergenic
1020828763 7:13066440-13066462 TTATTCCAAAATGCATTAATTGG - Intergenic
1021021618 7:15606148-15606170 TTTCTACAAAATCCCTTTATGGG + Intergenic
1021281792 7:18728661-18728683 TTATTTTAAAATCCATTTTCAGG + Intronic
1021857927 7:24876124-24876146 TTAAGTCAACAACCATTTATGGG + Intronic
1022547802 7:31205040-31205062 TTATTTCAAAAGACATTTTTTGG - Intergenic
1022916228 7:34956801-34956823 TTATTTAAAAACCCATTTTTCGG - Intronic
1023107913 7:36780803-36780825 TTAGTGCAGAATCCACTTTTGGG - Intergenic
1023457449 7:40356028-40356050 ATATTTCAAAATCCATTTAACGG - Intronic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1023877803 7:44298241-44298263 TTTGTTGAAAATCAATATATGGG - Intronic
1024456738 7:49616895-49616917 TTATTTAAATATCCATGTATAGG + Intergenic
1024861750 7:53852435-53852457 TTAGTTGAAAATCTTTGTATGGG + Intergenic
1025074550 7:55931699-55931721 GTAGTTCAAAAGCCATGGATGGG + Intronic
1025136944 7:56424736-56424758 TCAGTTAAATATCCACTTATGGG - Intergenic
1025818334 7:64940873-64940895 TTAATTAAATATCCATTTTTAGG + Intergenic
1026528755 7:71178995-71179017 TTAGATAAAAATCCATTGAAAGG - Intronic
1026809461 7:73450532-73450554 TTAGTTTTAAATCCTTTGATTGG - Intronic
1028675342 7:93453882-93453904 TTGGTTAAAAGACCATTTATTGG + Intronic
1028863781 7:95684050-95684072 TTACTTTAAAATAAATTTATTGG - Intergenic
1030635074 7:111939213-111939235 ATTGTTTAAAATCTATTTATGGG + Intronic
1030655062 7:112158340-112158362 TTTGTTCAAAAAGTATTTATTGG - Intronic
1031168258 7:118257901-118257923 TTAGCTCAAAGTTCATTTTTTGG - Intergenic
1032914842 7:136478369-136478391 TTAGCTGGAAATCCATTTGTGGG - Intergenic
1033341212 7:140493715-140493737 TTGGTTTAAAATCCATTTACAGG + Intergenic
1033836084 7:145313933-145313955 TTACTTCAAAAAACAGTTATTGG + Intergenic
1035544080 8:466125-466147 TTAGTTCTGAATCCATGCATTGG + Intronic
1036164137 8:6416167-6416189 TTAGTTCTAAATATATTTGTGGG + Intronic
1039146912 8:34457667-34457689 TTAGTTCAAAATCTGATCATCGG - Intergenic
1039514088 8:38116842-38116864 ATAGTTCAAACTCAATTTTTAGG + Intronic
1042184746 8:66125410-66125432 TTCCTTCAAAATACATTCATTGG - Intergenic
1043281330 8:78470668-78470690 TTACTTGCACATCCATTTATAGG - Intergenic
1043515891 8:80994290-80994312 TCATTTGAAAATGCATTTATTGG - Intronic
1044186653 8:89261213-89261235 ATAGTTCTATATCCAATTATTGG - Intergenic
1044965445 8:97569579-97569601 TTATTTCAACATTCAATTATAGG - Intergenic
1045285475 8:100787619-100787641 TAAGTTAAAAATGCATTTATTGG - Intergenic
1045621884 8:103988088-103988110 TTTTTTCAAAATGGATTTATTGG - Intronic
1045836101 8:106523588-106523610 TTATTTCATAGTCCATTAATGGG + Intronic
1046104714 8:109651650-109651672 TTAGTTCATAATACAGTTATAGG + Intronic
1046162107 8:110379356-110379378 TTACTTATAAAACCATTTATTGG - Intergenic
1046669172 8:117038809-117038831 TTAGTTTAAAATCATCTTATTGG - Intronic
1046978686 8:120312640-120312662 GTAGTTGAAAATATATTTATAGG - Intronic
1047559461 8:125970977-125970999 TTATTTCAATAGACATTTATTGG + Intergenic
1047999408 8:130365348-130365370 TCAATTCAAAACACATTTATGGG - Intronic
1048565359 8:135590555-135590577 TTATTTCAAAAACCATCTTTAGG - Intronic
1050718609 9:8558884-8558906 TTACTTCAAAATTCCTTTAGAGG + Intronic
1051187693 9:14477722-14477744 TTACTTCATAATCCATATAATGG + Intergenic
1051603117 9:18893935-18893957 TTAATCCAACATACATTTATGGG + Intronic
1052476193 9:28962663-28962685 TTAGAGCAAAATCTAGTTATTGG - Intergenic
1052486369 9:29105626-29105648 TTAGCTCAAAATCAGTTGATTGG - Intergenic
1054849871 9:69836558-69836580 TGAGTTCACAATACATTGATGGG - Intronic
1055451449 9:76434736-76434758 TTACTTGCACATCCATTTATAGG - Intronic
1057023697 9:91719961-91719983 TTATTTCAAGAGCCAATTATTGG + Intronic
1057579306 9:96272066-96272088 TGAGTTAAAAATACATATATAGG + Intronic
1058066752 9:100557005-100557027 TTAGTACATAATCCATTAACTGG - Intronic
1059090505 9:111352400-111352422 TTTGTTCAAAATGAATTTTTAGG - Intergenic
1185689137 X:2138834-2138856 TTATTTCAAAATCAACTTATTGG - Intergenic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186724487 X:12342756-12342778 TTAATTCATAATTCATTTAGCGG + Intronic
1187286337 X:17907594-17907616 TTAATTCAACAAGCATTTATTGG - Intergenic
1187620396 X:21047026-21047048 TTAGTTGAAAATCCTTCAATTGG + Intergenic
1187820316 X:23280416-23280438 TTAATTTAAAATCTATATATTGG + Intergenic
1188384282 X:29536657-29536679 TTAGTTCAAAATATGTTTAAAGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190746940 X:53329569-53329591 TCAGTTCAACAAACATTTATTGG + Intergenic
1192590342 X:72354453-72354475 TTAATTCAACATACATTTAAGGG - Intronic
1193208603 X:78778877-78778899 TTAATTCAAAAACCATGTCTTGG + Intergenic
1193517314 X:82483134-82483156 TAAGTTCAAAACCCAAATATTGG + Intergenic
1193849104 X:86514035-86514057 TTAGTTTAGATTCCATTTACAGG - Intronic
1194319988 X:92434086-92434108 TTAGGTTAAAATACATCTATAGG - Intronic
1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG + Intronic
1194418567 X:93644232-93644254 GTATTTCAAAATCCTTTTTTTGG + Intergenic
1194675322 X:96787305-96787327 TTAGTTCAAAATCCATTTATTGG - Intronic
1194837887 X:98703759-98703781 TTACTTCAAAATCTATTAAAAGG - Intergenic
1194975030 X:100385999-100386021 TTAATTCAACAAACATTTATTGG + Intronic
1195070935 X:101278710-101278732 TTATTTCAAAAGCCATTCCTTGG - Intronic
1196300967 X:114049614-114049636 TTTCTTCAAAAAACATTTATTGG - Intergenic
1197159212 X:123304958-123304980 AATGTTCAAAATCCATTTCTAGG + Intronic
1197896597 X:131322078-131322100 TTAGTTGAACAAACATTTATTGG + Intronic
1200633025 Y:5612744-5612766 CTAGGTCAAAACCCATTTTTAGG + Intronic