ID: 1194680166

View in Genome Browser
Species Human (GRCh38)
Location X:96842563-96842585
Sequence CCATGTATAAAATACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194680161_1194680166 11 Left 1194680161 X:96842529-96842551 CCTAACTTAGCATTTCCATAGGA 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1194680164_1194680166 -4 Left 1194680164 X:96842544-96842566 CCATAGGAGGAGGAAAATGCCAT 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1194680159_1194680166 22 Left 1194680159 X:96842518-96842540 CCTTTAGGAATCCTAACTTAGCA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194680166 Original CRISPR CCATGTATAAAATACCTACT AGG Intronic
900036350 1:412965-412987 CCATTTATCAAATGCCTACATGG + Intergenic
906743397 1:48204775-48204797 CCATGTATGCAATAGCCACTTGG - Intergenic
907840058 1:58148283-58148305 CCATGTAGAAAATACCCTGTAGG - Intronic
908188870 1:61679923-61679945 CTATATAAGAAATACCTACTTGG - Intergenic
908393069 1:63700738-63700760 CCAAGTATTAAAGGCCTACTAGG - Intergenic
910753851 1:90664787-90664809 CCAGGTATAAAATCCCAGCTTGG + Intergenic
910834832 1:91498333-91498355 ACATGGATAAAATACTTGCTTGG - Intergenic
912304731 1:108555905-108555927 ACATGTATTGAATACCCACTAGG + Intergenic
918963380 1:191307749-191307771 TCATGTATGAAATACTTCCTTGG - Intergenic
919049892 1:192499824-192499846 ACATCTATAAAATACCTTCATGG - Intergenic
919817981 1:201453792-201453814 CCATGTTTTAAAGGCCTACTTGG - Intergenic
922973857 1:229767174-229767196 CCATTTATTAAATAGCTATTTGG + Intergenic
924133607 1:240939121-240939143 CCATATACATAGTACCTACTAGG - Intronic
924340089 1:243021312-243021334 CCATTTATCAAATGCCTACATGG + Intergenic
1063140217 10:3250130-3250152 CCATGTATAAAATGAATATTTGG + Intergenic
1064897224 10:20250950-20250972 CCTTATATAAAATACTTACATGG + Intronic
1068383815 10:56296653-56296675 CCAAGTAAAAAATACCTCCCTGG - Intergenic
1068535622 10:58238225-58238247 CCATATATGAATTTCCTACTTGG + Intronic
1069159037 10:65068446-65068468 ACATGTACAAAATGCCTGCTGGG + Intergenic
1069495867 10:68902712-68902734 CCTTTTTTAAAATACCTGCTTGG - Intronic
1071168647 10:82836474-82836496 CCATGTATAAATTTTCAACTCGG + Intronic
1072002561 10:91211211-91211233 ACATGTATACAATACTGACTTGG + Intronic
1074712365 10:116188064-116188086 CCCTATATATAATACATACTGGG + Intronic
1074746000 10:116533326-116533348 CCATGTAAGAAATACCAACTTGG - Intergenic
1077948994 11:6933883-6933905 CCATGTGTAAAATCCAAACTGGG + Intronic
1078609075 11:12803786-12803808 CCATCTTTAAAATACTTAATAGG - Intronic
1078705415 11:13739194-13739216 ACATCTGTAAAATACCTACCTGG + Intergenic
1079501904 11:21110353-21110375 CCATGTAAAAAATTCTCACTGGG + Intronic
1079653358 11:22958888-22958910 CCAAATATAAACTAACTACTGGG - Intergenic
1080735980 11:35013993-35014015 CCATGTAGACAATACCTTGTAGG - Intronic
1081927129 11:46840166-46840188 ACATGTATTGAATGCCTACTGGG - Intronic
1085862459 11:80250315-80250337 TCATTTATAGAGTACCTACTAGG - Intergenic
1089145253 11:116324738-116324760 CCAAGTATAAAATATACACTGGG - Intergenic
1089250448 11:117156288-117156310 CCATTTATCAAGTACCTAGTGGG + Intronic
1092977203 12:13756849-13756871 CAATCTATTAAATACCAACTTGG + Intronic
1094528859 12:31253100-31253122 CAATGTATAAAATATTTCCTAGG - Intergenic
1096421260 12:51459964-51459986 TCATGAAAAAAATTCCTACTGGG + Exonic
1096590087 12:52652246-52652268 CCATGTACACAACACCTAGTTGG - Intergenic
1098376972 12:69826324-69826346 CCAGGTAGACAATACCAACTTGG - Intronic
1100938384 12:99695964-99695986 GCATTTAAAAACTACCTACTGGG + Intronic
1103142478 12:118561046-118561068 CAAGGTATAAAATACACACTGGG + Intergenic
1104332731 12:127862436-127862458 TCATATATAAAATACCCACCTGG - Intergenic
1105803143 13:23928345-23928367 CCAAGTATAAAATGACTACTGGG - Intergenic
1108561287 13:51646593-51646615 ACATTTATCAAACACCTACTAGG - Intronic
1115881670 14:37926394-37926416 CCATGTATAATACACCTTCCAGG + Intronic
1117312252 14:54539645-54539667 CTATGTAATAAATACCTTCTAGG + Intergenic
1119188021 14:72658319-72658341 CTATATATAAAATACTTACAAGG + Intronic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1122164059 14:99807875-99807897 ACATTTATGAGATACCTACTAGG - Intronic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1139453518 16:67052267-67052289 CTTTTTAAAAAATACCTACTAGG + Intronic
1146429944 17:32783386-32783408 CCATGTATAAAATAATTAAATGG + Intronic
1150422783 17:65053988-65054010 CAATTTATAAAATAACTTCTAGG + Intronic
1150567876 17:66358437-66358459 CCATGTGCAAAGTACCTTCTAGG - Intronic
1150741225 17:67780391-67780413 ACATCTACAAAATACCTTCTAGG + Intergenic
1150901806 17:69287190-69287212 ACATGTGTGAAATATCTACTTGG - Intronic
1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG + Intronic
1155489985 18:26391312-26391334 CCATTTTTGAAATACCTTCTTGG - Exonic
1156945400 18:42823421-42823443 GCATTTATCAAATACCTACTTGG + Intronic
1161527070 19:4762872-4762894 CCATTTATTGAAAACCTACTAGG - Intergenic
1161681759 19:5683351-5683373 CCATGTGTCAAATGCCTTCTGGG + Intronic
1164899445 19:31906040-31906062 CCATGTAAAAAATACCAGTTAGG + Intergenic
925470629 2:4157467-4157489 ACATTTATTAAGTACCTACTAGG - Intergenic
925551603 2:5082006-5082028 ACATGTATTACATACTTACTTGG - Intergenic
925669605 2:6297099-6297121 GCATGTATAAAATATGTAATAGG - Intergenic
925896095 2:8473434-8473456 CCATTTATGGAATACCTACTTGG + Intergenic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
935554093 2:104488314-104488336 ACATGTATTAAATACATCCTAGG + Intergenic
937697441 2:124823812-124823834 CCATGCACCAGATACCTACTTGG - Intronic
938606355 2:132896722-132896744 CTAGGTATAAAATACCTCCTTGG - Intronic
939269467 2:139918675-139918697 CCATTTATTAAGTATCTACTTGG + Intergenic
940021392 2:149159909-149159931 ACATATAAAAAATACCTTCTTGG + Intronic
940482053 2:154245338-154245360 TCATGGAGAAAACACCTACTAGG - Intronic
940662754 2:156567961-156567983 TCAAGTATAATGTACCTACTGGG + Intronic
940957496 2:159744286-159744308 CCTTGTATAGAACTCCTACTAGG - Intronic
942343734 2:174978964-174978986 ACATGTATTAAGTACCAACTAGG + Intronic
943470241 2:188286454-188286476 CATTGTTTAAAATATCTACTGGG - Intergenic
943777658 2:191784271-191784293 ATAAGTATAAAATACATACTGGG - Intergenic
944267429 2:197744139-197744161 CTAAGTGTAAAATACATACTGGG - Intronic
946388225 2:219399155-219399177 CCATCTATAAAATGCCTACCTGG - Intronic
946743981 2:222827798-222827820 CCATTTATTGAATGCCTACTAGG + Intergenic
1170350796 20:15438914-15438936 CCATTAAGAAAATACCAACTGGG - Intronic
1172090961 20:32432319-32432341 ACATGTATGAAATGTCTACTAGG + Intronic
1182403128 22:30098930-30098952 TCATGTATAACATACCTAAGGGG + Exonic
1183040688 22:35175606-35175628 CCTTGTATTAATCACCTACTAGG - Intergenic
1183755859 22:39763616-39763638 CCAAGTAGAAAATACATAATAGG - Intronic
1183907554 22:41053496-41053518 TCCTGAATAAAATACATACTAGG - Intergenic
949627186 3:5880106-5880128 CCATCCATAAAATACGTTCTAGG - Intergenic
954913081 3:54124598-54124620 CCATAAATAAAATACGTACTTGG - Intronic
956477567 3:69639035-69639057 CTTTGTTTAAAATACATACTAGG - Intergenic
957991210 3:87630140-87630162 TGATGTAAAAAATGCCTACTGGG - Intergenic
958427998 3:94001720-94001742 ACATGTATCAAACACCTCCTTGG - Intronic
958858598 3:99417883-99417905 CCATGTATACAATGCATACCTGG + Intergenic
962058857 3:131904156-131904178 TCATGTGTAAAATATCCACTTGG - Intronic
962452421 3:135531456-135531478 CCATGTATAAGGTACCTAACAGG - Intergenic
963791051 3:149582841-149582863 TCAAGTATAAAATATGTACTTGG + Intronic
964568634 3:158088281-158088303 ATATTTATTAAATACCTACTGGG - Intergenic
965325492 3:167298518-167298540 TCATTTATCAGATACCTACTTGG + Intronic
965822641 3:172700058-172700080 CCATTTGTAGAATACCTATTGGG - Intronic
966306053 3:178536172-178536194 CCATATAGAAAATATCTATTTGG + Intronic
970054616 4:11957010-11957032 CCATGTAACACATACCCACTGGG - Intergenic
971143879 4:23955131-23955153 CCAGGTATTAAATACCAACATGG + Intergenic
971405405 4:26317951-26317973 CCATGACTGAAATACCTTCTTGG + Intronic
971873046 4:32269197-32269219 CCATGTTAAAAATATCTCCTTGG - Intergenic
976154004 4:82123142-82123164 CCATATTTAAAATGCCTACAGGG + Intergenic
976235128 4:82888976-82888998 CCAGGTATACAATCCCTAGTTGG + Intronic
979262765 4:118667264-118667286 CCATTTATCAAATGCCTACATGG - Intergenic
979465104 4:121027956-121027978 TGATGTAAAAAATACCTAATTGG + Intergenic
979764750 4:124450723-124450745 CCAAGATTAAAATCCCTACTTGG + Intergenic
980394627 4:132194354-132194376 CCATTTATAAAATATATAGTGGG + Intergenic
980403078 4:132319148-132319170 ACATGTCTGAAATACCTACCAGG + Intergenic
981886111 4:149674925-149674947 CAATTTTTAAAATTCCTACTGGG - Intergenic
982911261 4:161145390-161145412 TGATCTATAAAATACCCACTAGG + Intergenic
984690678 4:182722398-182722420 AAATGTATTAAATGCCTACTTGG + Intronic
987525709 5:19046798-19046820 ACATTTATAAAATACATACATGG + Intergenic
987794938 5:22615509-22615531 CCATTTATAAACTCCCTGCTAGG - Intronic
987812230 5:22852716-22852738 CCATTTATAAAATAACTAGTTGG + Intronic
989131499 5:38111638-38111660 GGATGTAGAAAATACTTACTGGG - Intergenic
990739769 5:58900584-58900606 CCATGAATTAAATGCATACTAGG + Intergenic
992805086 5:80329704-80329726 CCTTTTAAAAAATAGCTACTCGG - Intergenic
993182967 5:84578679-84578701 CCATTTAACAAATAACTACTTGG + Intergenic
993564738 5:89459230-89459252 ACATGTATATAATACATTCTGGG + Intergenic
993673422 5:90789342-90789364 CCATGTATATCATAGCTAGTAGG + Intronic
993767341 5:91877780-91877802 AAATGAAGAAAATACCTACTAGG - Intergenic
994754237 5:103775396-103775418 CCATATATAAATGAGCTACTTGG - Intergenic
994784252 5:104135435-104135457 CCCTGTCTACAATATCTACTTGG - Intergenic
995439659 5:112176257-112176279 CAATTAATAAAATACCTGCTGGG - Intronic
995617044 5:113976473-113976495 CCATGTATAACATACCATCCTGG - Intergenic
995733168 5:115267675-115267697 ACATATATTAAATACCTTCTTGG + Exonic
996565866 5:124879498-124879520 CCATGTAACACATACCCACTGGG - Intergenic
1000044187 5:157508124-157508146 ACATGTAGAAAATAACTAGTAGG - Intronic
1001133731 5:169085066-169085088 CCTTGGAGAAAATTCCTACTGGG + Intronic
1001138550 5:169123337-169123359 CCATGTGTAAACTACTGACTGGG - Intronic
1001912218 5:175530317-175530339 CCATTTATAAAATACGCATTTGG + Intergenic
1002737471 5:181405899-181405921 CCATTTATCAAATGCCTACATGG - Intergenic
1004026414 6:11823571-11823593 ATATGTATTGAATACCTACTAGG + Intergenic
1005834497 6:29697623-29697645 CTATGTATAAAATAACAAATAGG + Intergenic
1008463859 6:51807709-51807731 CCATATGTAAAATACATGCTTGG - Intronic
1008723279 6:54384614-54384636 CCATGTATAAAATTCCATGTTGG - Intronic
1009616042 6:66008901-66008923 CCATGAATAAAATACAAAATAGG - Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1012049592 6:94324259-94324281 ACATGTATAAATATCCTACTGGG + Intergenic
1016631829 6:146241822-146241844 AAACCTATAAAATACCTACTGGG + Intronic
1016724734 6:147349770-147349792 TCATTTATTAAATATCTACTGGG - Intronic
1017435176 6:154408941-154408963 CCATGTATAAAATAAATAAAAGG + Intronic
1018876080 6:167824464-167824486 GCATATGTGAAATACCTACTGGG - Intergenic
1023008437 7:35901464-35901486 ATATTTATAAAATACCTCCTGGG - Intronic
1024801261 7:53082796-53082818 CAATGTAGAAAATATTTACTAGG - Intergenic
1024980608 7:55154528-55154550 CGGTGTATTAAATACCTGCTTGG - Intronic
1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG + Intergenic
1029535561 7:101155306-101155328 CCATGAATAGAAGAGCTACTGGG + Intronic
1031047505 7:116908682-116908704 GCATATATAAAATACTGACTAGG - Intronic
1031881378 7:127202535-127202557 CCATCTATTGAATACCTACTGGG + Intronic
1032353737 7:131190036-131190058 ACATATATAAAATACCTGGTGGG + Intronic
1033105798 7:138521726-138521748 CAATGTATAAAATACTTAATGGG + Intronic
1035505552 8:126699-126721 CCATTTATCAAATGCCTACATGG + Intergenic
1036418398 8:8572268-8572290 TCAGGGATTAAATACCTACTCGG + Intergenic
1036438435 8:8758081-8758103 CCACATATAAAATACCTCCTGGG - Intergenic
1036969691 8:13341253-13341275 CCATATATAAAAGAACCACTGGG + Intronic
1040415829 8:47194661-47194683 ACAGGTTTAAAATACCTTCTTGG - Intergenic
1040555105 8:48471451-48471473 CCATTTAGAAAATAACTGCTGGG - Intergenic
1040643341 8:49367689-49367711 ACATGTATTAAATAACTACCAGG - Intergenic
1042209841 8:66369168-66369190 TCATTTATTAAATACCTACAAGG + Intergenic
1043273337 8:78361770-78361792 CCATGTACATAGTACCTACCTGG - Intergenic
1044302423 8:90600924-90600946 AAATGTATAATATATCTACTAGG + Intergenic
1044428537 8:92082305-92082327 TCATGTAGAAAATTCCTACGTGG + Intronic
1045700175 8:104857149-104857171 TCAGGTATAAAATACCACCTGGG - Intronic
1050044795 9:1531646-1531668 CCATGAATAAAACATGTACTTGG + Intergenic
1050961515 9:11739178-11739200 CCATTTATAGAGTACCTATTAGG + Intergenic
1051694692 9:19755246-19755268 ACATGTATTGAATTCCTACTAGG - Intronic
1053843308 9:42209553-42209575 CCATCTATAAATTAGCTAATAGG + Intergenic
1058022574 9:100104411-100104433 ATATTTATAAAATACCCACTTGG + Intronic
1058238948 9:102531296-102531318 GAATGTATAAAATTTCTACTAGG + Intergenic
1058250540 9:102689743-102689765 ACATATATAAACTACATACTGGG - Intergenic
1060073212 9:120569017-120569039 ACATGTATTACACACCTACTCGG + Intronic
1060593928 9:124836747-124836769 CCATGTACAAAATACCTTATGGG + Intergenic
1187650533 X:21399343-21399365 CCATATAAAAAATACCTATAAGG - Intronic
1189217811 X:39342410-39342432 CTCTGTTTAAAATACCTAGTTGG - Intergenic
1189580058 X:42396533-42396555 ACATGTTTAAATTACCTGCTTGG + Intergenic
1192299779 X:69887800-69887822 CCAGGTATAATATTCCTAGTTGG - Intronic
1192343969 X:70286049-70286071 GCATGTTTAAAATACCCATTTGG - Intergenic
1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG + Intronic
1195528047 X:105916787-105916809 CAATATATAAAATCCATACTTGG + Intronic
1197390426 X:125856553-125856575 ACATTTATGAAATATCTACTGGG + Intergenic
1197898668 X:131344389-131344411 CCATTAATAAAGTACCTAATAGG + Intronic
1200639366 Y:5699336-5699358 CCCAGTGTAGAATACCTACTCGG - Intronic
1202384829 Y:24315723-24315745 CCATTTATCAAATGCCTACATGG - Intergenic
1202485955 Y:25354399-25354421 CCATTTATCAAATGCCTACATGG + Intergenic