ID: 1194683053

View in Genome Browser
Species Human (GRCh38)
Location X:96877632-96877654
Sequence AGATGGACTTAGTCTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194683053 Original CRISPR AGATGGACTTAGTCTGAGCA TGG (reversed) Intronic
901921840 1:12542218-12542240 GGAGGGACTTATTCTGACCAGGG - Intergenic
903284284 1:22267452-22267474 AGATGGCCTTAGTTTGGGCAGGG + Intergenic
905022448 1:34827173-34827195 ACATGGACTTTCTCTGGGCAGGG - Intronic
906535497 1:46548848-46548870 AGATGGATTCAGGCTGGGCACGG + Intronic
907773778 1:57492534-57492556 AAATGTACTTAGTCTGAGTGAGG + Intronic
914708469 1:150191109-150191131 ACATGGACTTAGGGTGAGGAGGG - Intergenic
916842791 1:168616836-168616858 AGATAGATATAGTCTGAACAAGG + Intergenic
916901987 1:169235852-169235874 AGAGGGACTTATTCTTATCAAGG + Intronic
917034749 1:170735955-170735977 AGATGGATGTACTCTCAGCATGG - Intronic
917082970 1:171275157-171275179 AGATGGAGGTAGTCTAAGCTTGG - Intronic
918437923 1:184535647-184535669 AGATGGACTTTATCTTAGTAGGG + Intronic
919155491 1:193760319-193760341 AGATGGGATTAGGCTGGGCATGG + Intergenic
922599416 1:226838306-226838328 AGGTGGACTGAGTCCGAGAAAGG - Intergenic
1063170631 10:3506814-3506836 AGGTGGAGTTAGACTGAGAAAGG + Intergenic
1063275350 10:4561237-4561259 AGATGAAGTTAGTCTGAGGCTGG - Intergenic
1064636676 10:17375627-17375649 AGCCGCACTTAGTCTGTGCAAGG + Intronic
1064860672 10:19821689-19821711 GGATGGACAAAGTCTTAGCATGG - Intronic
1073770617 10:106731359-106731381 AGATGGACCCAGTCTGTGCAGGG - Intronic
1077099709 11:816710-816732 GGATGGACTGAGTCTGGGCTGGG - Intergenic
1077553134 11:3211931-3211953 AGGTGGACTGAGTCTGAAAAAGG - Intergenic
1078662955 11:13301909-13301931 AGATGAACTTGGTCTGATCTTGG - Intronic
1079018540 11:16889347-16889369 AGGTGGACTGAGTCTGAGAAAGG - Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079182633 11:18207342-18207364 AGATAAACTCAGTCTGGGCAAGG + Intronic
1080181383 11:29430579-29430601 AGATGGATTTAGTTTGGGGAAGG - Intergenic
1080559039 11:33445170-33445192 AGAAGGACTGAGTCTGATGAGGG + Intergenic
1080908558 11:36572049-36572071 AGATGAACATACTTTGAGCAGGG - Intronic
1082964997 11:58958157-58958179 AGAAGGACTTAGTGTCATCATGG + Intronic
1083372970 11:62196195-62196217 TTAGGGACTTAGTCTGAGCTGGG - Intergenic
1089972565 11:122705851-122705873 GGATTGATTTAGTCAGAGCAAGG - Intronic
1099484645 12:83213654-83213676 AGCTGGGCTTTGTCTGAACAGGG + Intergenic
1100490843 12:95076369-95076391 AGATGAACTTCGGCTGGGCACGG - Intergenic
1101023902 12:100582098-100582120 AGGTGGACTGAGTCTGAAAAAGG + Intronic
1101228302 12:102712287-102712309 TGATGGATTTAGTGTGGGCAAGG + Intergenic
1102537692 12:113593404-113593426 AGATTGAATTGGTCTGAGGAGGG - Intergenic
1108725459 13:53175844-53175866 AGATTGAGTAAGTCTGAGAATGG - Intergenic
1112565726 13:100550105-100550127 AGATGGACCCACTCTGTGCAGGG - Intronic
1112596592 13:100813414-100813436 AGTTGGTCTTAGTCTTAGCTTGG + Intergenic
1113548217 13:111171179-111171201 AAATGGAATTAGCCTGAGGAAGG + Intronic
1121271204 14:92639332-92639354 AGGTGGACGAAGTGTGAGCAAGG + Intronic
1121514345 14:94539404-94539426 AGAAGGACGATGTCTGAGCAGGG + Intergenic
1122400887 14:101466699-101466721 AGATTGAATTAGACTGAGCTGGG + Intergenic
1125379235 15:39069831-39069853 ACATGGCCTTATTCTGTGCATGG - Intergenic
1128745616 15:70111989-70112011 CGATGGAATGATTCTGAGCAGGG - Intergenic
1128972745 15:72121970-72121992 AGATGGAGTTTGACTGAGGAAGG - Intronic
1130206502 15:81880419-81880441 TGATGGACGTAGGCTCAGCATGG + Intergenic
1132059936 15:98684037-98684059 GGAGGGACTGAGGCTGAGCACGG - Intronic
1132531345 16:451542-451564 AGAAGGACTTAGGCCGGGCATGG + Intronic
1133909519 16:10052407-10052429 AAAAGGACTTAGGGTGAGCATGG - Intronic
1136623626 16:31447378-31447400 AAATGGAATTAGGCTGGGCACGG + Intergenic
1138333125 16:56231169-56231191 GGCTGGGCTGAGTCTGAGCATGG - Intronic
1141333751 16:83136191-83136213 AAATAGACTTTGTCTGGGCACGG + Intronic
1141550855 16:84805833-84805855 AGAGAGACTGAGGCTGAGCATGG + Intergenic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1148735817 17:49864372-49864394 ACAGGGACATATTCTGAGCATGG - Intergenic
1150573927 17:66413195-66413217 AGATGAACTGAGCCTGAGAAGGG - Intronic
1152619975 17:81358281-81358303 TGATGAACTTGGTCTGAGCAGGG + Intergenic
1153746691 18:8186901-8186923 AGATTGACTTAGAGTGGGCAAGG + Intronic
1156758216 18:40554595-40554617 AGATGAATTTAATCTCAGCAGGG - Intergenic
1158134375 18:54190264-54190286 AGATGGGCTTAGGCTGGGAATGG - Intronic
1158592018 18:58785689-58785711 AGATGCAGTTACTCTGGGCAGGG + Intergenic
1159130452 18:64275403-64275425 AGGTGGACTGAGTCTGAAAAAGG + Intergenic
1161375120 19:3935893-3935915 AAATTGATTTAGTCTCAGCAGGG - Intronic
1165990713 19:39811237-39811259 AGATGAATTTAGGCTGGGCATGG - Intergenic
1166240997 19:41493655-41493677 AGAAATACTTAGTCTGAGAAGGG - Intergenic
1166707572 19:44916525-44916547 AGATGGTCTTGGGCTGGGCACGG + Intronic
1168135426 19:54348025-54348047 AGGTGGACTGAGTCTGAGAAAGG + Intergenic
930464226 2:51724973-51724995 ACATTCACTTAGTCTCAGCAAGG - Intergenic
933891406 2:86774818-86774840 AGATGGACTTGGTTTGAGGGAGG + Exonic
935053649 2:99545856-99545878 AGATGTAATTAGTTTGAGAACGG + Intronic
936731875 2:115391871-115391893 AGATCTACTTACACTGAGCAAGG - Intronic
940779529 2:157918104-157918126 CGTTGGACTTTGCCTGAGCAAGG + Intronic
942803891 2:179907280-179907302 AGATGGAATAAGTTTGAGCCAGG + Intergenic
945214978 2:207423750-207423772 AGAATGACTTAGGCTGGGCATGG - Intergenic
946804954 2:223462705-223462727 AGGTGGACTGAGTCTGAAAAAGG - Intergenic
948306121 2:236948106-236948128 AGATGGACCTAGTCCCAGCGTGG - Intergenic
1168839020 20:897138-897160 AGGTGGACTGAGTCTGAAAAAGG - Intronic
1169783766 20:9336531-9336553 AGATGGACTGAGTCAGAGTCTGG - Intronic
1169868081 20:10221501-10221523 AGATGGACATAGGATGAGCCAGG + Intronic
1171238603 20:23547489-23547511 TGATGGAGTTATTCTCAGCAGGG - Intergenic
1171243031 20:23586782-23586804 TGATGGAGTTATTCTCAGCAGGG + Intergenic
1177250426 21:18584417-18584439 TAATGGACTCAGTCTGAGAAAGG - Intergenic
1183283139 22:36943717-36943739 AGATGCACTGCGTCTGAGCTGGG - Intergenic
1183748509 22:39705864-39705886 GGATGGACTGGGTCAGAGCAAGG - Intergenic
1184650079 22:45915644-45915666 AGATGGAGTTAGTGGGAGCTGGG - Intergenic
949534803 3:4987248-4987270 AGCTGGATTTAGGCAGAGCACGG + Intergenic
951387797 3:22063812-22063834 AGTTGTACTTAGTTGGAGCAAGG - Intronic
953233701 3:41087335-41087357 GGATGCTCTTGGTCTGAGCATGG - Intergenic
954162057 3:48729877-48729899 AAGTGGACTGAGTCTGAGAAAGG + Intronic
955718012 3:61851184-61851206 AGATGGACTTTGTTGGAGAAAGG + Intronic
958768555 3:98399434-98399456 TAATGGATTTAGTCTGGGCATGG + Intergenic
959689313 3:109181291-109181313 AGAAGCACTTAGCTTGAGCACGG - Intergenic
959816909 3:110684238-110684260 AGGTGGGCTGAGTCTGAGAAAGG - Intergenic
960727025 3:120680928-120680950 AGATGAACTGAGTCTGGGCTAGG - Intronic
961040253 3:123673401-123673423 ACATGCACTGAGGCTGAGCATGG - Intronic
962100035 3:132332375-132332397 AGATGGACCTAGAATGAGGAAGG + Intronic
962294801 3:134173547-134173569 GGATGGAGTGAGTGTGAGCAGGG + Intronic
963224757 3:142850998-142851020 AGTTGGCCTTAGTAGGAGCAGGG + Intronic
964421845 3:156511556-156511578 AGATGGACTGAGTGTGGTCAGGG - Intronic
967270529 3:187728909-187728931 AGATTGAGTTAGTCTGAGTAAGG - Intronic
967842988 3:194021875-194021897 AGAAGGACTTAGTTCCAGCAGGG - Intergenic
972103837 4:35457496-35457518 AGAGGGACCTTGTGTGAGCAAGG + Intergenic
972344952 4:38184986-38185008 AGAAAAATTTAGTCTGAGCATGG + Intergenic
973903879 4:55507021-55507043 AAATGGACCTAGGCTGGGCACGG + Intronic
975173781 4:71263227-71263249 AGATGTACTGTGTCTCAGCAAGG + Intronic
979821205 4:125174380-125174402 AGAAGGAGTAAGTCTAAGCAGGG - Intergenic
980593138 4:134917359-134917381 AGGTGGACTGAGTCTGAAAAAGG - Intergenic
982068381 4:151673951-151673973 AGATGCTCTGAGTCTCAGCAGGG + Intronic
983472458 4:168173947-168173969 CGCTGGACTCAGTCAGAGCAGGG + Intronic
988338903 5:29943209-29943231 GGATGGAGTGAGTGTGAGCAGGG + Intergenic
989798659 5:45507371-45507393 ATCTGGCCTTAGTCTGAGCATGG + Intronic
994145874 5:96394141-96394163 AGCTGGACCTATTCAGAGCAGGG + Intronic
994190354 5:96862277-96862299 AGATTGATTTAGACTGGGCAGGG - Intronic
996392082 5:122972915-122972937 ACATGGACTTACACTCAGCAAGG - Intronic
997464697 5:134079461-134079483 AGATGGACTTAGTCTCCACTCGG + Intergenic
999850818 5:155536533-155536555 AGAGGGACTTGGTCTGAGCCTGG + Intergenic
1004459634 6:15823700-15823722 AGATGGATTTACTCTGACAAGGG - Intergenic
1004778605 6:18878655-18878677 AGATGGACTTAATATAAGAATGG - Intergenic
1005072061 6:21871051-21871073 AGGTGCACTGAGACTGAGCAGGG + Intergenic
1008713215 6:54255054-54255076 AGATGCTCTTGGTCTGAGAATGG + Intronic
1008783193 6:55132706-55132728 AAATGGAGTTGGTCTGAGTAGGG - Intronic
1008840522 6:55897645-55897667 AGTAAGACTTAGTCTGAGGAGGG + Intergenic
1010872314 6:81058611-81058633 AGATGTACTTCTTCAGAGCAAGG - Intergenic
1012803846 6:103869565-103869587 ACCTGGACTTGGGCTGAGCATGG - Intergenic
1016181729 6:141155262-141155284 AGAGGAACTTATGCTGAGCAAGG + Intergenic
1016341365 6:143064885-143064907 AGGCGGACTGAGTCTGAGAAAGG + Intronic
1021883292 7:25114267-25114289 AGATTCATTTAGGCTGAGCATGG - Intergenic
1022862121 7:34378075-34378097 AAATGGACTTAGTCTCATTATGG + Intergenic
1023911566 7:44560268-44560290 AGAGGGTCTTAGCCTGGGCAGGG + Intergenic
1024188115 7:46975616-46975638 AGATGAACTTAATCCAAGCATGG + Intergenic
1024222852 7:47302055-47302077 ATATGGATTGAGTTTGAGCAGGG - Intronic
1024387160 7:48765617-48765639 AAATGCATTTACTCTGAGCAGGG - Intergenic
1028755246 7:94426645-94426667 AGATGGAGTTAGCCAGAGAATGG - Intronic
1041144084 8:54853517-54853539 AGATGGAGTTTATCTGTGCACGG - Intergenic
1048574997 8:135683287-135683309 AGATTGATTTGGTCTGAGCGGGG + Intergenic
1048697688 8:137046947-137046969 TCATGCATTTAGTCTGAGCATGG + Intergenic
1050353838 9:4764560-4764582 AGATGGAGTCAGGCTGGGCATGG + Intergenic
1051882953 9:21858772-21858794 AGATGGTCTTAGTCCTAGCACGG - Intronic
1055501825 9:76908995-76909017 AGATGGAGTAAGTCTGGGCGCGG - Intergenic
1057499538 9:95585716-95585738 TGATGGTCTCAGTCTCAGCAGGG - Intergenic
1058279975 9:103102463-103102485 AGATGGGCTTAGTCTGGTTAAGG + Intergenic
1058951793 9:109910809-109910831 AGAGGGACTGAGGCTGAGGAGGG + Intronic
1188243917 X:27819401-27819423 TGAAGGCATTAGTCTGAGCAGGG + Intronic
1194683053 X:96877632-96877654 AGATGGACTTAGTCTGAGCATGG - Intronic
1196179120 X:112671201-112671223 AGAGGGACACAGTCTGATCATGG - Exonic
1201484243 Y:14475340-14475362 AGGTGGACTGAGTCTGAAAAAGG + Intergenic
1201540916 Y:15103702-15103724 AAGTGGACTGAGTCTGAGAAAGG + Intergenic