ID: 1194690193

View in Genome Browser
Species Human (GRCh38)
Location X:96974902-96974924
Sequence TAGGGTTCTCTAGAGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194690193 Original CRISPR TAGGGTTCTCTAGAGGCTTC AGG Intronic
902770366 1:18642437-18642459 AAAGGTTCTCTAGAGGCTCTGGG + Intronic
903723919 1:25427071-25427093 TAGGTTTCTCTAGGGGATACAGG + Intronic
905439383 1:37984722-37984744 TTGGATTCTCTCGAGCCTTCAGG + Exonic
906087585 1:43149004-43149026 TAGGGCCCTGCAGAGGCTTCAGG - Intronic
906533080 1:46534531-46534553 TAGGATTCTCTAGATGTCTCTGG + Intergenic
907526878 1:55058864-55058886 AAGGGTTTCCTAGAGGCTGCAGG + Intronic
907969431 1:59366419-59366441 AAGGCTTTTCTAAAGGCTTCCGG - Intronic
910342406 1:86203034-86203056 AAGGGCTCTCCTGAGGCTTCGGG + Intergenic
910487294 1:87729455-87729477 AAGGGCTCTCTTGAGACTTCAGG + Intergenic
911344928 1:96684837-96684859 TCCTGTTCTCTAGTGGCTTCTGG - Intergenic
912387365 1:109278385-109278407 TAGGGTACTGCAGAGGTTTCCGG + Intergenic
915379551 1:155428006-155428028 TAGGCTTCTGGGGAGGCTTCAGG - Intronic
915419089 1:155765524-155765546 TAGGGTTGTTTAGAGACTCCTGG + Exonic
917186649 1:172363962-172363984 AAGAGTTTTCTAGAGGTTTCAGG - Intronic
918611565 1:186498212-186498234 TAGGGTTCACAAGAGGCTCCTGG - Intergenic
1063826902 10:9908474-9908496 TTGGCTTCTGGAGAGGCTTCAGG + Intergenic
1064927001 10:20580459-20580481 CATGGTTCTCTGGAGGATTCAGG + Intergenic
1065353099 10:24813039-24813061 TAGGGTTCTTATGAGGATTCAGG - Intergenic
1069359616 10:67626581-67626603 TGTGGTTCTCAAGAGGCTTCAGG - Intronic
1071007767 10:80902153-80902175 GAAAGTTCTCTAGCGGCTTCAGG - Intergenic
1072328069 10:94318059-94318081 TAGAGCTCTGTAGAGGCTTTAGG - Intronic
1073636602 10:105205440-105205462 TAGGGTTCGCTTGAGGCTGGTGG - Intronic
1083206455 11:61152517-61152539 TAGTGTTCTCTCGAGGTTACTGG - Intronic
1085191495 11:74628982-74629004 TAGAGTTCTCTAGAGACTGCTGG - Intronic
1086651628 11:89297886-89297908 TTTGTTTCTCTAGAGGCTTGAGG + Intergenic
1087086440 11:94223526-94223548 TAGGGTACACCAGAGGCTGCAGG - Intergenic
1090079071 11:123599092-123599114 TTGGATTCTCTCGAGCCTTCAGG + Intronic
1090212773 11:124934576-124934598 TAGGGTTCTCTCCTAGCTTCTGG - Intronic
1090292104 11:125554604-125554626 CAGTGTTATCTAAAGGCTTCTGG - Intergenic
1102060961 12:109930788-109930810 CGGGCTTCTGTAGAGGCTTCTGG - Exonic
1102600046 12:114022783-114022805 TCGGCTTCTGTAGAGGCCTCAGG + Intergenic
1103686773 12:122738384-122738406 AAGTGTTTTCTAGATGCTTCAGG + Intergenic
1107375206 13:39796816-39796838 TAGTGTTTTCTTGAGGCTACAGG + Intergenic
1109502337 13:63254763-63254785 TTGGCTTCTCGGGAGGCTTCAGG + Intergenic
1110300298 13:73918774-73918796 TAGGGTTCTCTTAACACTTCTGG - Intronic
1114544806 14:23491438-23491460 TAGGTAATTCTAGAGGCTTCGGG + Intronic
1116219879 14:42070045-42070067 TAGGTTTCTCTGGAGGCTTATGG - Intergenic
1117063274 14:51983968-51983990 TAGGCTTCTGGAGAGGCCTCAGG - Intergenic
1117194819 14:53329329-53329351 TAGGGTTATTTTGAGGATTCGGG + Intergenic
1120265759 14:82248710-82248732 TAGGCTTCTCATGAGGCCTCAGG - Intergenic
1124879224 15:33626139-33626161 TAGGGTTTTCTAGAAGATGCTGG + Intronic
1126226428 15:46275812-46275834 TCAGGTTCTCTGGAGGCTTTGGG + Intergenic
1129325996 15:74800577-74800599 TGGGGTTCTCTGGAGGTTCCTGG - Intronic
1129640576 15:77372926-77372948 TAGGGTTCTGGTGAGGCTTCAGG - Intronic
1129689961 15:77707597-77707619 TACGGTTCCCCAGAGGCTGCTGG + Intronic
1130036606 15:80366960-80366982 TGGTGTTATCTAAAGGCTTCTGG + Intronic
1130397561 15:83516533-83516555 TTGGGTTCTAGGGAGGCTTCGGG + Intronic
1139267425 16:65653112-65653134 TAGGGTTCAATAAAGTCTTCTGG - Intergenic
1140400678 16:74668680-74668702 TTGGGTTTTCTAGAGTCATCAGG - Intergenic
1143672228 17:8404856-8404878 CAGGTTACTCTAGAGGCTCCTGG - Intergenic
1146523883 17:33549402-33549424 TAGGGTTCTCAAGAATCATCAGG + Intronic
1147378006 17:40034396-40034418 TGGGCTACTCTCGAGGCTTCAGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148911161 17:50943851-50943873 AAGGGGTCTCGAGGGGCTTCTGG + Intergenic
1149369690 17:55980632-55980654 AAGGGTTCTCAGGAGGCTCCTGG + Intergenic
1149991535 17:61386299-61386321 TCGGGTTCTCTTGAGGCTGGGGG + Intronic
1154496060 18:14962437-14962459 TAGGATTTTATAAAGGCTTCAGG - Intergenic
1155651397 18:28147765-28147787 CAGGCGTCTGTAGAGGCTTCTGG - Exonic
1158515378 18:58126306-58126328 TAGGGTTCTCCAGGGGCTCAGGG - Intronic
1158963730 18:62606386-62606408 TAGGAGGCTCTAGAGGGTTCTGG + Intergenic
1160801565 19:972645-972667 TAGGGTTTTTAAGAGGTTTCGGG + Exonic
1164915370 19:32047614-32047636 TAGGGGTCTGCAGAGGCCTCGGG + Intergenic
1166124600 19:40706367-40706389 TGGAGTTCTCCAGAGGCTCCAGG + Intronic
1167213600 19:48149401-48149423 TAGGGTTCCCCAGAGCCGTCAGG - Intronic
1167433289 19:49465225-49465247 TAGGGTCCTCCAGAGGCTCATGG + Intronic
1168368185 19:55807583-55807605 AAGGTTTATCTAGAAGCTTCAGG - Intronic
1168675451 19:58274821-58274843 TAGAGTTTTCCAGAGGCTGCTGG - Intronic
925214815 2:2085280-2085302 TGGGGGTCTCTAGAGGATTTGGG - Intronic
932607488 2:73175083-73175105 TAGGGTTCTATGGAGCCTTTCGG - Intergenic
932885641 2:75546940-75546962 CAGGGTTCTCCAATGGCTTCTGG - Intronic
933998202 2:87685462-87685484 AAGGGCTCTCCAGAGGCTTTAGG + Intergenic
934216023 2:90032308-90032330 TAGGGTTCTCTAGAGGGAAAGGG + Intergenic
934792108 2:97070187-97070209 AAGGGCTCTCCAGAGGCTTTAGG - Intergenic
934814511 2:97313523-97313545 AAGGGCTCTCCAGAGGCTTTAGG + Intergenic
934823182 2:97394960-97394982 AAGGGCTCTCCAGAGGCTTTAGG - Intergenic
936295648 2:111265411-111265433 AAGGGCTCTCCAGAGGCTTTAGG - Intergenic
946453291 2:219799521-219799543 CAGGGTTCTCTACAGGCTTGAGG - Intergenic
948495576 2:238346443-238346465 TAGAGTCCTCTAGAGCCTCCCGG + Intronic
948602250 2:239114002-239114024 CAGTGGTCTCCAGAGGCTTCTGG - Intronic
1171034092 20:21702749-21702771 GAGGGTACCCCAGAGGCTTCGGG - Intergenic
1173731305 20:45330546-45330568 TATGGTTATCTAGAGGCACCTGG + Exonic
1175526449 20:59637913-59637935 TAGAGCTCTCATGAGGCTTCAGG - Intronic
1177730201 21:25019306-25019328 TAAGTTTCTCTACAGACTTCTGG - Intergenic
1182365615 22:29776984-29777006 GAGGGTACCCTAGAAGCTTCTGG + Intergenic
1182776844 22:32837638-32837660 TAGGGGTTTCTTGGGGCTTCGGG + Intronic
1183777572 22:39976876-39976898 TTGGGTTCTCCATAGTCTTCAGG + Intergenic
1184074501 22:42167606-42167628 TTGGGGTCTCTAGAAGCTGCAGG - Intronic
1184515231 22:44957703-44957725 TAGGTTTCTCTCCAGGCTGCTGG + Intronic
1185292072 22:50032197-50032219 CAGGGTTCTCTAGAGCCAGCTGG - Intronic
951673194 3:25207924-25207946 TTGGGTTCTGAAGAGGCCTCAGG + Intronic
951936826 3:28031502-28031524 TTGGTTTCTCCAGAGGCCTCTGG - Intergenic
953186268 3:40641056-40641078 AAGGTTTCTCTTGAGGCTGCAGG - Intergenic
959096740 3:101964702-101964724 GGGAGTTCTCTAGAGGCTGCGGG + Intergenic
959911408 3:111767927-111767949 TAGGGTTATCTAGAGGAAGCAGG + Intronic
961414280 3:126746010-126746032 GAGGCTTCTCTGGAGGATTCTGG + Intronic
962616265 3:137129987-137130009 GAGGGTTCACCACAGGCTTCAGG - Intergenic
963173990 3:142279806-142279828 TGGTGTTATCCAGAGGCTTCTGG + Intergenic
964343880 3:155736678-155736700 TAGTGTTCTCTAAGGTCTTCTGG - Intronic
965345488 3:167543890-167543912 TAGGGTTTTCTAGAGAAGTCAGG - Intronic
978458316 4:108920585-108920607 TAGGGTCCTCTAGGGCCTCCGGG - Exonic
978656315 4:111069787-111069809 TAAGGTTCTCTATAGGCATATGG - Intergenic
978670086 4:111237321-111237343 TGGGGTGCTCTAGATGCTACTGG - Intergenic
984739786 4:183149961-183149983 TAGGGTACCCAGGAGGCTTCTGG + Intronic
986241064 5:5960662-5960684 TGGGGTTCTCTAGAGGTGACTGG - Intergenic
987182349 5:15380923-15380945 TCGCCTTCTCGAGAGGCTTCAGG - Intergenic
988593207 5:32567277-32567299 TTGGCTTCTGTGGAGGCTTCAGG - Intronic
994601434 5:101910443-101910465 TAGGGTTCTCTTGAGGGTGGAGG - Intergenic
995040446 5:107581809-107581831 TTGGGTTCTCATGAGGCTTCAGG - Intronic
995605559 5:113850851-113850873 TAGGCTTCTGTGGAGGCCTCAGG + Intergenic
996669231 5:126097527-126097549 TAGGCTTCTGGTGAGGCTTCAGG - Intergenic
997732378 5:136191132-136191154 TAGGGCTCTTCAGGGGCTTCAGG + Intergenic
998374343 5:141681253-141681275 AGGGGTACTCCAGAGGCTTCTGG + Intronic
998570630 5:143253712-143253734 CAGGTTTATCCAGAGGCTTCTGG - Intergenic
999544614 5:152613387-152613409 TAGGGTTCTGGAGAGGCATATGG + Intergenic
1000943484 5:167392045-167392067 TAGGGTTCCCTGATGGCTTCCGG + Intronic
1006804827 6:36781275-36781297 TAGATTTCTCTGGAGGCTCCAGG - Intronic
1012754842 6:103215634-103215656 TTGGTTTCTCTAGATGCTTGTGG - Intergenic
1015093864 6:129390817-129390839 TAGGATTCTCCAGGTGCTTCAGG - Intronic
1015242199 6:131037190-131037212 TAGCGTTCTGTAGATGCTTGTGG - Intronic
1017392857 6:153959857-153959879 TTGGCTTCTGTAGAGGCCTCAGG + Intergenic
1018130459 6:160726529-160726551 AAGGGATCTCAAGAGACTTCAGG - Intronic
1020366658 7:7387972-7387994 TAGGGAAGTATAGAGGCTTCTGG - Intronic
1021301543 7:18979669-18979691 TTGGCTTCTCCAGAGGCCTCAGG + Intronic
1025028257 7:55535542-55535564 TAGGGTTCTCTAGAGGTGCATGG - Intronic
1025571610 7:62578730-62578752 TAAGTTTCTCAGGAGGCTTCTGG + Intergenic
1027199572 7:76054852-76054874 TAGGGGCCTCTGGAGGCATCGGG + Exonic
1028479099 7:91285020-91285042 TAGAGTTCTATAGAAGTTTCAGG - Intergenic
1028637311 7:93004044-93004066 AAGGGTACTCTAGAGGCTTGAGG + Intergenic
1028896790 7:96050256-96050278 TGGACTTCTCTATAGGCTTCAGG - Intronic
1032579127 7:133087766-133087788 TAGGCATCCCTAGAAGCTTCTGG - Intergenic
1032983677 7:137314185-137314207 TAGGGTACTATAGAGCCTTCCGG - Intronic
1035409997 7:158632148-158632170 GAGGTTTTTCTAAAGGCTTCAGG - Intronic
1035463642 7:159061974-159061996 GGGGCTCCTCTAGAGGCTTCAGG - Intronic
1037031721 8:14115224-14115246 CAGGATTCTCTAGAAGCCTCAGG - Intronic
1042599824 8:70487941-70487963 AAGGGTGCTCTAGAGGCTTCTGG + Intergenic
1044248211 8:89975908-89975930 GAGGTTCCTCAAGAGGCTTCAGG + Intronic
1046766563 8:118075713-118075735 TCGGGTTCTCCTGAGGCCTCAGG + Intronic
1047158881 8:122353744-122353766 TAGAGGTCAATAGAGGCTTCAGG + Intergenic
1047710923 8:127551560-127551582 TAGGGCACTGTAAAGGCTTCAGG - Intergenic
1048446124 8:134494564-134494586 TGGGGTTCCGTGGAGGCTTCAGG - Intronic
1053071147 9:35102804-35102826 CAGGGCTCTCTACTGGCTTCTGG - Exonic
1057866432 9:98685452-98685474 TAGGGAACTCTAGAGGGTTCAGG - Intronic
1059625879 9:116065593-116065615 TATGCTTCTCTAGTAGCTTCTGG - Intergenic
1061561529 9:131407286-131407308 TACGGTTTTTTAGACGCTTCGGG + Intronic
1185680486 X:1884892-1884914 TAGCCTTCTCTAGAGGCTCTAGG + Intergenic
1187333637 X:18363100-18363122 TAGGCTTCTGGTGAGGCTTCAGG - Intergenic
1187685952 X:21815619-21815641 GAGGGTTATGAAGAGGCTTCAGG - Intergenic
1192723842 X:73727486-73727508 TTGGGTTCTCAATAGGCTTAGGG - Intergenic
1194690193 X:96974902-96974924 TAGGGTTCTCTAGAGGCTTCAGG + Intronic
1200094238 X:153649839-153649861 CAGGTTTCTCTAGTGGCCTCTGG - Intronic