ID: 1194691863

View in Genome Browser
Species Human (GRCh38)
Location X:96995900-96995922
Sequence CTATCTGCTTTGATTAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194691863_1194691867 13 Left 1194691863 X:96995900-96995922 CCAAACCTAATCAAAGCAGATAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1194691867 X:96995936-96995958 ACTAGGCTTGAAAAAAAGAAAGG 0: 1
1: 0
2: 4
3: 42
4: 393
1194691863_1194691865 -4 Left 1194691863 X:96995900-96995922 CCAAACCTAATCAAAGCAGATAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1194691865 X:96995919-96995941 ATAGTCCTATTTAAATAACTAGG 0: 1
1: 0
2: 0
3: 14
4: 215
1194691863_1194691868 14 Left 1194691863 X:96995900-96995922 CCAAACCTAATCAAAGCAGATAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1194691868 X:96995937-96995959 CTAGGCTTGAAAAAAAGAAAGGG 0: 1
1: 0
2: 2
3: 63
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194691863 Original CRISPR CTATCTGCTTTGATTAGGTT TGG (reversed) Intronic
900852698 1:5156593-5156615 CTTTCTGTTTTAATCAGGTTTGG - Intergenic
902736659 1:18405720-18405742 CCACCTGCTTTGCTTAGGCTGGG - Intergenic
904958907 1:34315439-34315461 CTATCTCCCTTGATATGGTTCGG + Intergenic
907030283 1:51164177-51164199 CTATTTGCTTAGATTTGCTTTGG - Intergenic
909189333 1:72532249-72532271 ATATCTGCAGTGATAAGGTTTGG - Intergenic
909772917 1:79447123-79447145 CTATCAACATTGATTATGTTAGG + Intergenic
916309086 1:163374540-163374562 TTATCTCCTTTGATAAAGTTAGG + Intergenic
916384687 1:164254427-164254449 GTTTCTGCTTTGATATGGTTTGG + Intergenic
918690669 1:187475272-187475294 CTTTCTCCTTTGACTAGGGTGGG + Intergenic
919941650 1:202291097-202291119 CCATTTGTTTTGATTAGATTTGG + Intronic
923358380 1:233183053-233183075 CTATGTTCTTTTATTATGTTTGG + Intronic
1063869020 10:10398264-10398286 AAATCTTCTTTGATTATGTTAGG - Intergenic
1064066272 10:12184601-12184623 TTATCAGCTTAAATTAGGTTTGG + Intronic
1064903793 10:20322304-20322326 CTATTTGGTTTTATTTGGTTTGG - Intergenic
1064945228 10:20779542-20779564 TAATCTGCTTTGATATGGTTTGG - Intergenic
1065754035 10:28914278-28914300 ATGTCTGCATTGGTTAGGTTGGG - Intergenic
1066044575 10:31584278-31584300 ATCTCTGCTTTGATTAGGGGTGG - Intergenic
1066746964 10:38610509-38610531 CTCTCTGTTTCCATTAGGTTTGG + Intergenic
1067466709 10:46504489-46504511 CTTTCTTCTTGGTTTAGGTTTGG - Intergenic
1067620479 10:47880116-47880138 CTTTCTTCTTGGTTTAGGTTTGG + Intergenic
1068424346 10:56839379-56839401 GTATCTCCTTTGATTAGATGAGG + Intergenic
1071357951 10:84817560-84817582 TTATCTTCTTTGATGTGGTTGGG + Intergenic
1071971548 10:90912971-90912993 TTATCTCATTTGATTAGGCTGGG - Exonic
1072842982 10:98795727-98795749 CTAGCTGCACTGATTAGGCTGGG - Intronic
1074254120 10:111783308-111783330 ATTTCTGCTTGCATTAGGTTTGG - Intergenic
1077205535 11:1341355-1341377 CTGTCTGCCTGGTTTAGGTTGGG + Intergenic
1077205596 11:1341816-1341838 CTGTCTGCCTGGTTTAGGTTGGG + Intergenic
1081248352 11:40797493-40797515 CTATCTGCAGTTAGTAGGTTAGG + Intronic
1084909024 11:72372782-72372804 CTCTCTGCTATGCTTGGGTTAGG + Intronic
1084994330 11:72960707-72960729 CTCTCTGCTTTGATAATGTTGGG + Intronic
1086531456 11:87791242-87791264 CTTTTTGCTTAGATTTGGTTTGG - Intergenic
1086833095 11:91589984-91590006 CCATCTGCTATTTTTAGGTTTGG + Intergenic
1090932045 11:131306526-131306548 CTCTGTGTTTTGATTAGGTTTGG + Intergenic
1095407680 12:41885747-41885769 CTCTCTGATTTGATTAGCTTAGG + Intergenic
1097676254 12:62604963-62604985 ATATGTGCCTTGATTGGGTTTGG + Intergenic
1105489868 13:20877718-20877740 ATATTTGTTTGGATTAGGTTTGG - Intronic
1106717056 13:32401407-32401429 GTATCTCCTTTGAGTAAGTTTGG - Exonic
1108378925 13:49838670-49838692 TTATCTGCTTTGATTCAATTCGG - Intergenic
1110998437 13:82143798-82143820 TTATTTGCTTTGATTAGCTAAGG + Intergenic
1113207576 13:107934914-107934936 GTATCTTCTTTGATTAGTTTTGG + Intergenic
1115126037 14:29994971-29994993 CCATCTGTTTTGATTACTTTGGG + Intronic
1116199476 14:41772309-41772331 CTATCAGATTTGATATGGTTTGG - Intronic
1116616443 14:47146437-47146459 CTGTCTGGTTTTATTAAGTTCGG + Intronic
1117052173 14:51871922-51871944 CAGTCTGCTTTGGTTAGGTGTGG + Intronic
1117517550 14:56517307-56517329 CTATCTGTTAAGATTAGCTTTGG + Intronic
1118151661 14:63196437-63196459 CTCTCTGCCTTGTTTGGGTTAGG - Intergenic
1118928269 14:70214140-70214162 CTATATGCTGTGATTAGGGCTGG - Intergenic
1119643588 14:76331757-76331779 CTTTCTGCTTGGTTTGGGTTGGG + Intronic
1120768285 14:88351993-88352015 CTATGTGCTTTGATTAGGCTGGG + Intergenic
1124187002 15:27539540-27539562 ATGACTGCTTTGATTTGGTTAGG + Exonic
1125294814 15:38191184-38191206 CGTTTTGCTTTGATTTGGTTTGG + Intergenic
1128820013 15:70643337-70643359 CTATAAGCTTTGATTCGTTTTGG + Intergenic
1130734853 15:86537282-86537304 CCATCTGCTCTGATTGGGCTTGG + Intronic
1131079705 15:89524415-89524437 CAATCTGATTGGATTAGATTAGG - Intergenic
1135205241 16:20478384-20478406 CTATCTGCCTGGAATAGTTTAGG - Intronic
1136736101 16:32469136-32469158 CTCTCTGTTTCCATTAGGTTTGG - Intergenic
1137838556 16:51618705-51618727 CTATCAGAAGTGATTAGGTTTGG - Intergenic
1142098315 16:88257728-88257750 TTATGTGCATTGATGAGGTTTGG + Intergenic
1203016971 16_KI270728v1_random:360438-360460 CTCTCTGTTTCCATTAGGTTTGG + Intergenic
1203035306 16_KI270728v1_random:633596-633618 CTCTCTGTTTCCATTAGGTTTGG + Intergenic
1146107251 17:30051101-30051123 CTTTCTTCTTTGCTTAGGTAGGG + Exonic
1155552314 18:26977727-26977749 CCATTTGCTTTCATTAGGTCAGG + Intronic
1159490765 18:69131453-69131475 CTATTTGATTTGCTCAGGTTTGG + Intergenic
1165564261 19:36710619-36710641 CTATCTGCTTTCAGGAGGTTAGG - Intronic
1167440911 19:49508304-49508326 CTTTGTGATGTGATTAGGTTAGG + Intronic
926473341 2:13289810-13289832 ATTTCTGCTTTAATTAGCTTAGG - Intergenic
927279944 2:21295981-21296003 CTCTCTGCTTTCACTAGGATGGG + Intergenic
928862657 2:35876698-35876720 CTATATGCTTTCATGAGATTTGG + Intergenic
929534306 2:42770837-42770859 CTATCTGCTTTGTCTAGTTTTGG - Intronic
929983426 2:46701235-46701257 CTATCACCTTTGTTTAGATTGGG + Intronic
932729844 2:74211746-74211768 ATATCTGCTGTGATCAGATTTGG - Exonic
934187264 2:89758248-89758270 CTCTCTGTTTCCATTAGGTTTGG - Intergenic
934309364 2:91849676-91849698 CTCTCTGTTTCCATTAGGTTTGG + Intergenic
934775591 2:96935113-96935135 ATATCTGCTAGAATTAGGTTTGG + Intronic
937880793 2:126863028-126863050 GGATCTGCATTGATTAGGATAGG + Intergenic
939531726 2:143371574-143371596 TCATCTGGTTTGATTTGGTTTGG + Intronic
941329189 2:164156758-164156780 CTATATGCTTTGTTTATGTATGG + Intergenic
942306353 2:174611153-174611175 CTATCTGCGTTGATGATGTGTGG + Intronic
943123814 2:183771753-183771775 CTTTCTGCATTGATTTGTTTGGG - Intergenic
944402433 2:199343631-199343653 CCATCTACCTTGATTAGGTTGGG + Intronic
944852352 2:203732965-203732987 CTACCAGCTATGATTTGGTTTGG + Intronic
945123580 2:206484724-206484746 CTATCTCCCTTGATATGGTTTGG + Intronic
947829968 2:233132685-233132707 CAAACTGCTTTGATTAGAATAGG + Intronic
948494170 2:238335624-238335646 ATATATGCTTTCATTAGTTTAGG + Intronic
1169293127 20:4369829-4369851 CTCTCTACTCTGCTTAGGTTAGG - Intergenic
1169524097 20:6404115-6404137 TTACCTGCCTTGATTACGTTGGG + Intergenic
1169779462 20:9293567-9293589 CTTTCTGCCTTGATTTGTTTTGG + Intronic
1170213088 20:13864642-13864664 GTATCTGTTTTGTTTTGGTTTGG + Intronic
1175149616 20:56923156-56923178 CTATCTGATTTCATTAAATTGGG + Intergenic
1177184844 21:17781921-17781943 TTATTTGATTTGATTTGGTTTGG - Intergenic
1177515516 21:22146942-22146964 CTTTGTGCTTTGATGTGGTTTGG + Intergenic
1177690166 21:24495551-24495573 ACATATGGTTTGATTAGGTTTGG + Intergenic
1177890111 21:26794719-26794741 ATTTCTGCTTTAATTAGCTTAGG + Intergenic
1180001994 21:44999339-44999361 CTCTCTGCATTGCTTAGGTGGGG - Intergenic
1180536454 22:16396801-16396823 CTCTCTGTTTCCATTAGGTTTGG + Intergenic
950274705 3:11649893-11649915 CTATTTGGTTTGGTTTGGTTTGG + Intronic
950631785 3:14286842-14286864 CTCTCTCCTTTGGTTAGGATGGG - Intergenic
950934978 3:16830021-16830043 CTTTCTGATTTGATTTGATTTGG + Intronic
962307518 3:134301513-134301535 TTATCAGATATGATTAGGTTTGG - Intergenic
965038972 3:163481786-163481808 CTTTGTGCTTTGATATGGTTTGG + Intergenic
966146657 3:176820565-176820587 TAATATGCTTTGATTAGCTTTGG - Intergenic
966161138 3:176969731-176969753 CTCTCTGCTTTGAGGAGCTTAGG - Intergenic
966392258 3:179465113-179465135 ATATCTGCTGTGATCAGATTTGG - Intergenic
970991038 4:22213395-22213417 ATATCTACTTTGATATGGTTTGG - Intergenic
971030079 4:22626553-22626575 CCATTTGCTTTCATTAGGTCAGG + Intergenic
972926516 4:44015519-44015541 TTATCTGCTCTGATATGGTTTGG + Intergenic
974542844 4:63261687-63261709 CTTTATACTTTGATTAGTTTGGG + Intergenic
974590837 4:63945994-63946016 CTTTCTGCTTTGAATTGCTTAGG + Intergenic
976235138 4:82889114-82889136 CTTTCTCCTTTGATTTGGTTTGG - Intronic
977285006 4:95092891-95092913 ACATCTACTTTGATTAGCTTCGG + Intronic
977665342 4:99640640-99640662 ATATGTTCTTTTATTAGGTTTGG - Exonic
979013730 4:115404266-115404288 ATATTAGCTTAGATTAGGTTTGG + Intergenic
980712401 4:136587240-136587262 CTTTTTTCTTTGATTAGGTTAGG - Intergenic
981012788 4:139942810-139942832 ATATCTGCTTTATTTAGCTTTGG - Intronic
982304701 4:153918410-153918432 GTATCTGCTTTTGTTAGCTTGGG + Intergenic
982994476 4:162323627-162323649 ATATCTGCTGTGATCAGATTTGG - Intergenic
984667587 4:182445628-182445650 CAATTTGCTTTGATTTGGTTTGG + Intronic
987484796 5:18511588-18511610 ATTCCTGCTTTAATTAGGTTAGG - Intergenic
988938135 5:36111253-36111275 AAATCTGCTTTTATTAGTTTGGG - Exonic
990548928 5:56852806-56852828 CTATCTGTTTAGATTAGCTTTGG + Intronic
991646178 5:68802634-68802656 CTAACTGCATGGCTTAGGTTGGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
997498109 5:134347825-134347847 CTATCTGCTTTCATTCGCTATGG - Intronic
1000990585 5:167907882-167907904 CTATCAGATTTAATTAAGTTAGG - Intronic
1001129274 5:169050198-169050220 GACTCTGCTTTAATTAGGTTTGG - Intronic
1006610269 6:35290444-35290466 CTTTCTGCTTTGATTGGAATTGG + Intronic
1006667767 6:35709007-35709029 CTATCAGTTAAGATTAGGTTTGG - Intronic
1007306298 6:40908075-40908097 CTATCTGCTTTAAATTGCTTTGG - Intergenic
1008613905 6:53207995-53208017 CTTTCTACTTTGATTTAGTTGGG - Intergenic
1011836535 6:91437741-91437763 CAGTTTGCTTTGATTGGGTTAGG - Intergenic
1011873159 6:91922571-91922593 CTTTCTGCTTAGATTGGATTTGG - Intergenic
1012004880 6:93701159-93701181 CTATCTGAGTTTATTAGTTTGGG - Intergenic
1013417779 6:109940085-109940107 CTACCTCCTTTGAGTAGGGTAGG - Intergenic
1015177175 6:130322644-130322666 CCATTTGCTTTGGTTTGGTTTGG - Intronic
1023149773 7:37191341-37191363 CTAACTACTTTGATTTAGTTGGG - Intronic
1028635006 7:92978071-92978093 CTTTCTGCTTTCTTTAGGCTTGG + Intergenic
1029887628 7:103889855-103889877 CTACCTGCTTGGAGGAGGTTGGG - Intronic
1030063718 7:105643065-105643087 CCATCTGCCTTCACTAGGTTAGG + Exonic
1030438258 7:109552507-109552529 CTTTCAGCTCTGATCAGGTTGGG - Intergenic
1034811971 7:154140187-154140209 CTCTCTGGTTGGAGTAGGTTAGG - Intronic
1038013383 8:23493069-23493091 TTATCTGTTTTGTTTAGGGTTGG + Intergenic
1038116065 8:24556578-24556600 CTGTGTGCATTCATTAGGTTTGG + Intergenic
1038600122 8:28931945-28931967 ATCTCTACTTTGATAAGGTTGGG + Intronic
1039407380 8:37325189-37325211 CTAGGTGCTTTCATTATGTTGGG - Intergenic
1039548800 8:38428914-38428936 CTATCTGCTCTGATTAAGGAGGG - Intronic
1046635154 8:116667168-116667190 CTTTTTGCTTTGATTTGGCTTGG - Intronic
1049092658 8:140528296-140528318 CTTTCTGCTCTGGTTTGGTTTGG - Intergenic
1049981068 9:904201-904223 CTTTCAGATTTGATTTGGTTTGG + Intronic
1051192385 9:14527920-14527942 CTAGCTGCGGTTATTAGGTTAGG + Intergenic
1051522288 9:18002613-18002635 TTATCAGCTTTGATGAGTTTGGG + Intergenic
1061276857 9:129573825-129573847 ACATCTGCTTTGGTTTGGTTTGG - Intergenic
1061485967 9:130920681-130920703 CTATCTGGTTTAAGGAGGTTTGG - Intronic
1187041226 X:15598095-15598117 CTATCTGTTTTATTTAGGCTTGG - Intronic
1187149929 X:16672117-16672139 CTCTCTGCTAAGAATAGGTTTGG + Intronic
1187652230 X:21421599-21421621 ATATCTGCTTTCATTTTGTTTGG + Intronic
1190439744 X:50465382-50465404 CTATTTGCTTTGGTGAGGGTGGG + Intronic
1193829863 X:86276983-86277005 CTTTTTGCTTAGAATAGGTTGGG + Intronic
1194029423 X:88793309-88793331 CTAGCTTCTTAGATTAAGTTAGG - Intergenic
1194691863 X:96995900-96995922 CTATCTGCTTTGATTAGGTTTGG - Intronic
1195597198 X:106705361-106705383 CTATCTGCATTGAGGAGATTAGG + Intronic
1200112620 X:153749630-153749652 CTCTCTGTTTCCATTAGGTTTGG + Intergenic