ID: 1194692040

View in Genome Browser
Species Human (GRCh38)
Location X:96999104-96999126
Sequence TCCCTATAGTGTCTGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194692038_1194692040 15 Left 1194692038 X:96999066-96999088 CCTTTGACAATTTTGACAGTATT 0: 1
1: 0
2: 1
3: 80
4: 1273
Right 1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
1194692037_1194692040 21 Left 1194692037 X:96999060-96999082 CCTACACCTTTGACAATTTTGAC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194692040 Original CRISPR TCCCTATAGTGTCTGTGAGC TGG Intronic
900467611 1:2833372-2833394 TCCAAAGAGAGTCTGTGAGCGGG - Intergenic
902186103 1:14726531-14726553 TTCCTCGAGTGTCTGTGGGCTGG + Intronic
905863159 1:41363385-41363407 GCCCTGTGGTGCCTGTGAGCTGG + Intronic
914666843 1:149839792-149839814 TCTCTACAGTCTCTGGGAGCTGG - Exonic
914668924 1:149853998-149854020 TCTCTACAGTCTCTGGGAGCTGG + Exonic
918211890 1:182358496-182358518 TCCCCTTAGTGTCAGTGACCTGG - Intergenic
920521336 1:206629372-206629394 TCCCTATACTGTCTCAAAGCAGG - Intergenic
921047617 1:211488725-211488747 TCCCTCTTTTGTCTGGGAGCCGG + Intronic
921868283 1:220109420-220109442 GCCCTCTACAGTCTGTGAGCTGG - Intronic
924186646 1:241498544-241498566 TCCCTGTAATGTCTGGGAGGAGG - Intronic
1063273202 10:4535258-4535280 TCCTTATAGTGTATGTGATAAGG + Intergenic
1063728783 10:8671590-8671612 TCCTTACATTGGCTGTGAGCTGG + Intergenic
1065825829 10:29570360-29570382 TCCCAATAGTGCATTTGAGCTGG + Intronic
1065951527 10:30656281-30656303 TCCCAATAGTGCATTTGAGCTGG - Intergenic
1066323910 10:34334907-34334929 TCCTTATAGTAGCTGTGAGTTGG + Intronic
1069862686 10:71481358-71481380 TCCCAAGGGTGGCTGTGAGCTGG - Intronic
1072229219 10:93399464-93399486 TTCCTTTACTGTCTGTGAGAAGG + Exonic
1076608904 10:131708137-131708159 TCCCTATAGTGACTGAGGGTGGG + Intergenic
1079497006 11:21056134-21056156 TCCCTACTGTCTCTGTGATCTGG - Intronic
1081679951 11:44995046-44995068 TGCCTACAGTGTCTATGACCAGG - Intergenic
1081711220 11:45217062-45217084 TCCCTTTTGTATCTGGGAGCAGG + Intronic
1086449522 11:86902206-86902228 TCCCTATAGTTTCTGAGCACAGG - Intronic
1086956334 11:92937991-92938013 GTCCTATAGTGTCTGCGAGTGGG + Intergenic
1091112724 11:132985202-132985224 TTTCTATAGTTTCTGTGAGTAGG + Intronic
1096784137 12:54007530-54007552 TGCGTACAGTGTCTGTGAGGTGG + Intronic
1097589271 12:61553691-61553713 GCTCTATAGTGTCTATGGGCAGG + Intergenic
1106884142 13:34165153-34165175 TTCTTAAAGCGTCTGTGAGCCGG + Intergenic
1106947399 13:34843999-34844021 CCCCTATATTTTCTGTAAGCTGG + Intergenic
1107703748 13:43077647-43077669 TTCCTAAAGTGTCTGACAGCTGG + Intronic
1107857461 13:44630278-44630300 TCACCATAGTGTCTGTGGGGGGG + Intergenic
1111462546 13:88565470-88565492 TCCCTTTACAGTCTGTGAACTGG + Intergenic
1113126408 13:106984137-106984159 TCCCTACAGTGTCTGTGCTAGGG - Intergenic
1113336256 13:109378896-109378918 ACCCTATTGTGTCTCTAAGCTGG + Intergenic
1113846179 13:113393155-113393177 TCCCTGTTCTGTCTGTGAGAAGG - Intergenic
1114409614 14:22488467-22488489 TACCTATAGGATCTGTGAGTTGG - Intergenic
1119116488 14:72026705-72026727 GCCAAACAGTGTCTGTGAGCAGG - Intronic
1119220744 14:72905127-72905149 GCCCTCTAGTGTCAGTGAGCAGG + Intergenic
1121642706 14:95496466-95496488 TCCAAAATGTGTCTGTGAGCTGG + Intergenic
1123161133 14:106278832-106278854 TCCCTATAGGGTCTGTCTGGAGG + Intergenic
1123449013 15:20348991-20349013 TCCCTCCTGTGCCTGTGAGCTGG + Intergenic
1123924832 15:25097846-25097868 TTCCTGTACTGTATGTGAGCTGG - Intergenic
1127583861 15:60363191-60363213 TCCCAAAGGGGTCTGTGAGCTGG - Intronic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1139165336 16:64558806-64558828 TACCTATAGCTTCTGTGAGCTGG + Intergenic
1141140363 16:81493173-81493195 CCCCTGAAGTGTCTGTGTGCCGG - Intronic
1141683939 16:85559501-85559523 TCCCTGCAGTGTCTGGGATCTGG - Intergenic
1142563094 17:822756-822778 TCCCTATGCAGTGTGTGAGCAGG + Intronic
1152931556 17:83112821-83112843 TCCCAGCAGTGTCAGTGAGCTGG + Intergenic
1153534780 18:6089152-6089174 TCCCCATATTGTCTATTAGCTGG - Intronic
1165552286 19:36597565-36597587 TCTCCATAATGTCTGTGTGCAGG + Intronic
1168016681 19:53579412-53579434 TGCACATAGTGTCTGTGTGCTGG - Exonic
927283390 2:21331424-21331446 TACCTTTAGTGTCTCTGAACTGG + Intergenic
935056779 2:99574403-99574425 TCCCTATAATGCCTGTAAACAGG - Intronic
935066069 2:99649514-99649536 TCCCTAAAGTATCTCTGAACTGG - Intronic
936099218 2:109560434-109560456 TCCCTTTAGTATTTGTCAGCTGG - Intronic
936554286 2:113479894-113479916 TCCCTATAGCCTCTGTGTCCTGG + Intronic
937501338 2:122482414-122482436 TCCAAATCCTGTCTGTGAGCTGG - Intergenic
946355285 2:219180741-219180763 TTCCTACATTGTCTGTGAGTAGG + Exonic
1174887476 20:54351839-54351861 TCCCCAAAGTGTCTGGTAGCAGG + Intergenic
1178011514 21:28291568-28291590 TCCCGAGTGTGTCTGTGAGGGGG - Intergenic
1181636376 22:24176644-24176666 TCCCTCAAGTGTCTGTCACCAGG - Intronic
1181764360 22:25080448-25080470 ACCCTCTAGTGGATGTGAGCAGG - Intronic
1182740380 22:32563155-32563177 TACCTATAGTGCCTCTAAGCTGG - Intronic
1182764664 22:32750149-32750171 TCACTATATTGTATGTTAGCTGG + Intronic
1183543084 22:38441143-38441165 TCCCTCTCCTGTCTGTGAGCTGG - Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
952633837 3:35503270-35503292 TCCCTATAGAGTCTGAGAAAAGG - Intergenic
952841440 3:37649985-37650007 TCCATATAATGTCTATCAGCTGG + Intronic
953907289 3:46874730-46874752 TCCCTATTGTGTGTGTGGGGGGG - Intronic
956927846 3:74008612-74008634 TCACTATGCTGTCTGTAAGCTGG - Intergenic
962104733 3:132379038-132379060 GCCCTGTAGCGTTTGTGAGCAGG + Intergenic
966066886 3:175830216-175830238 TACCTAGAGTGTCTGTGAACTGG - Intergenic
967117669 3:186356396-186356418 TCTCTAGAGTGGCTGTGAGGGGG + Intronic
972745969 4:41933242-41933264 TTCAGTTAGTGTCTGTGAGCTGG + Intergenic
973969577 4:56198674-56198696 TCCCTTTATTGTCTGTAAGATGG + Intronic
974878016 4:67721242-67721264 TCCCTATACTGTCTCAGTGCAGG - Intergenic
981307735 4:143264443-143264465 TCCCTGTAGGGTCTGTGACCTGG + Intergenic
986481875 5:8197820-8197842 TCCCTGTAGTGTCCGTGAGCTGG + Intergenic
987403059 5:17497870-17497892 TCCCTCTTGTGACTCTGAGCAGG + Intergenic
990266900 5:54086371-54086393 TCCCTAAAGTTCCTATGAGCAGG - Intronic
992788901 5:80196313-80196335 TCGCTATAGTGTGTGTGAGGTGG - Intronic
995814760 5:116155141-116155163 GCCCTAGAGTGACTGTGAGATGG - Intronic
995913809 5:117218971-117218993 TGCCTGTAGTGTCAGAGAGCTGG - Intergenic
1002168180 5:177360941-177360963 TCCCTAAAGGGTCTGCAAGCTGG + Intronic
1008787621 6:55188287-55188309 TCCCTTTAGTAACTGTGATCAGG - Intronic
1014535094 6:122605405-122605427 TCCTCAGAGTGTCTGTCAGCTGG + Intronic
1017945752 6:159095046-159095068 TCCCTATATTGACTCTGACCAGG + Intergenic
1019038467 6:169083076-169083098 TGCCAACAGAGTCTGTGAGCCGG + Intergenic
1023552511 7:41385086-41385108 TCAGTATAGGGTCTCTGAGCAGG - Intergenic
1023854336 7:44172658-44172680 CCCTTTTTGTGTCTGTGAGCTGG - Intronic
1030855093 7:114545880-114545902 TCCACATAGTGTGTGTGTGCTGG - Intronic
1031023599 7:116655087-116655109 TCACTACAGTGGCTGTGAGTTGG - Intergenic
1034924249 7:155108241-155108263 TCCCAATTGTTTCTTTGAGCAGG + Intergenic
1035322556 7:158042698-158042720 TCACTATGGTGTCTATCAGCCGG - Intronic
1035454660 7:159000144-159000166 TCCCTATTGTGTCTGTCCACGGG - Intergenic
1036285274 8:7439086-7439108 TCCCTGAAGTTTGTGTGAGCGGG - Intergenic
1036336202 8:7872443-7872465 TCCCTGAAGTTTGTGTGAGCGGG + Intergenic
1040216578 8:45090215-45090237 TTCTTATAGTGTCTGGAAGCGGG + Intergenic
1041321911 8:56622233-56622255 TCCCTTTAGTGTCTGTGTTTGGG - Intergenic
1047167379 8:122454211-122454233 TCCCTTGAGTCTCTGTGAGCAGG + Intergenic
1049898721 9:137284-137306 TCCCTATAGCCTCTGTGTCCTGG - Intronic
1051842965 9:21419190-21419212 TCCCTAGAGTGTTTGTGTGAGGG - Intronic
1053741771 9:41147596-41147618 TCCCTATAGCCTCTGTGTCCTGG - Intronic
1054444765 9:65303743-65303765 TCCCTATAGCCTCTGTGTCCTGG - Intergenic
1054485506 9:65717760-65717782 TCCCTATAGCCTCTGTGTCCTGG + Intronic
1054686570 9:68283704-68283726 TCCCTATAGCCTCTGTGTCCTGG + Intronic
1061444046 9:130627529-130627551 AGCCCACAGTGTCTGTGAGCAGG - Intronic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1185827147 X:3262476-3262498 TTCCTAGAGTGTCATTGAGCTGG + Intergenic
1187311848 X:18152201-18152223 TGCCTCTACTGTCTGTGAGCAGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191033813 X:56004589-56004611 ACCCTACAGTCACTGTGAGCTGG - Intergenic
1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG + Intronic
1200210891 X:154346195-154346217 TCCCAACAGTGTCTGAGTGCTGG + Intergenic
1200219961 X:154385897-154385919 TCCCAACAGTGTCTGAGTGCTGG - Intergenic
1200904028 Y:8462984-8463006 CCACTATTATGTCTGTGAGCTGG - Intergenic