ID: 1194693043

View in Genome Browser
Species Human (GRCh38)
Location X:97010244-97010266
Sequence AGAGAGAGCACAATGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194693043_1194693050 28 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT No data
Right 1194693050 X:97010295-97010317 GCCATGTGGCCACTGCCAGGAGG No data
1194693043_1194693049 25 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT No data
Right 1194693049 X:97010292-97010314 CATGCCATGTGGCCACTGCCAGG No data
1194693043_1194693047 14 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT No data
Right 1194693047 X:97010281-97010303 GAATCTGTCTCCATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194693043 Original CRISPR AGAGAGAGCACAATGATTGT GGG (reversed) Intronic