ID: 1194693043

View in Genome Browser
Species Human (GRCh38)
Location X:97010244-97010266
Sequence AGAGAGAGCACAATGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 6, 2: 43, 3: 131, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194693043_1194693047 14 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT 0: 1
1: 6
2: 43
3: 131
4: 390
Right 1194693047 X:97010281-97010303 GAATCTGTCTCCATGCCATGTGG 0: 1
1: 0
2: 15
3: 42
4: 179
1194693043_1194693050 28 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT 0: 1
1: 6
2: 43
3: 131
4: 390
Right 1194693050 X:97010295-97010317 GCCATGTGGCCACTGCCAGGAGG 0: 1
1: 2
2: 3
3: 35
4: 234
1194693043_1194693049 25 Left 1194693043 X:97010244-97010266 CCCACAATCATTGTGCTCTCTCT 0: 1
1: 6
2: 43
3: 131
4: 390
Right 1194693049 X:97010292-97010314 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194693043 Original CRISPR AGAGAGAGCACAATGATTGT GGG (reversed) Intronic
900388665 1:2423475-2423497 AGAGAAAGCTTAATGATTGCAGG + Intergenic
901223521 1:7597588-7597610 AGAGAGAGGAGCATGATTGTGGG + Intronic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906390931 1:45415433-45415455 AGCGAAAGCACAAAGATTATGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908040390 1:60106457-60106479 TGAGAGAGCACAATGCTACTTGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910044860 1:82901172-82901194 AGAGAGAGCATAGTGTTGGTAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913648883 1:120890405-120890427 AGCAAGAGCACAAAGATTCTAGG - Intergenic
914077808 1:144372978-144373000 AGCAAGAGCACAAAGATTCTAGG + Exonic
914101371 1:144593527-144593549 AGCAAGAGCACAAAGATTCTAGG - Exonic
914172717 1:145241518-145241540 AGCAAGAGCACAAAGATTCTAGG + Intergenic
914297609 1:146344109-146344131 AGCAAGAGCACAAAGATTCTAGG + Intergenic
914527374 1:148482646-148482668 AGCAAGAGCACAAAGATTCTAGG + Exonic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918686005 1:187416469-187416491 AGAAAAAGCACAAAGATTGCAGG - Intergenic
918736109 1:188065626-188065648 AGAAAGAGAACAATGAATGAAGG - Intergenic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919230156 1:194763622-194763644 AGAGTGAGCACTATTATGGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919473959 1:198011608-198011630 AGAGAGAGAAAAATGTTGGTGGG - Intergenic
919648652 1:200123371-200123393 AGAGAGAGCAAAATGAGTTTGGG + Intronic
920105320 1:203548934-203548956 AGAGAAAGCAGAATAAATGTAGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923007305 1:230060886-230060908 AGAGAGAGCACAATGTTAAAAGG - Intronic
923371467 1:233318469-233318491 AGACACAGAACAATGATTATGGG - Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064416518 10:15154689-15154711 AGTGAGAGCACAAAGATTCTAGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066110111 10:32188212-32188234 AGCAAGAGCACAAAGATTCTAGG + Intergenic
1066160945 10:32727406-32727428 AAAGGAAGCACAATCATTGTTGG - Intronic
1067701865 10:48579639-48579661 GGAGAGAGAACAAGGAATGTGGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068701081 10:60020455-60020477 AGAGACATCACAAGAATTGTAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069111713 10:64455597-64455619 AGAGAGAGCATATTGAGTATTGG + Intergenic
1070286752 10:75089134-75089156 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1070658651 10:78289167-78289189 ATAGATAGCACACTGATGGTGGG - Intergenic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071956150 10:90761813-90761835 AGAGAGAGTAGCATGGTTGTTGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074057367 10:109934795-109934817 AGACAGAGCACAATAAATGTTGG + Intergenic
1074578113 10:114690036-114690058 AGCAAGAGCACAAAGATTCTAGG + Intergenic
1074601541 10:114918702-114918724 AGAAAGACCATAATGGTTGTAGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075107359 10:119549655-119549677 AGAAAGAGCACATTGGTGGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1078928667 11:15896424-15896446 TCAGAGAGCACGATGCTTGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080351004 11:31385944-31385966 AGGGAGAGCACCATGCTCGTAGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081479068 11:43466963-43466985 AGTGAGAGCACAAATATTATAGG - Intronic
1082844998 11:57717925-57717947 AGTGAGAGCACAAAGATTCTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085098591 11:73781049-73781071 AGAGAGAGAAAAAAAATTGTAGG + Intergenic
1085957417 11:81416340-81416362 ACAGAGAGCAGAATGGTGGTTGG - Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086872307 11:92053175-92053197 AGAAAGAGCAAAATAATTTTCGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1087632506 11:100667051-100667073 AGCGAGAGCACAAAGATGATAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1092473909 12:8802923-8802945 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092647754 12:10596315-10596337 AGTGATAGCACAATTATTATTGG + Intergenic
1093423354 12:18999872-18999894 GGAGAGAGCATAATGATTACTGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094478637 12:30862273-30862295 AGTGAGAGCACAAAGATTATAGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095902394 12:47341499-47341521 AGTGAGAGCACAAAGATTATAGG + Intergenic
1096152614 12:49323928-49323950 AGAGACATCACAAAGATTGGTGG + Exonic
1096368540 12:51048792-51048814 GGAGAGAGCGCAATGCCTGTGGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098103475 12:67043671-67043693 GGAGAGAGCAACATGATTCTTGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099751893 12:86784886-86784908 AGAGAAAGGGAAATGATTGTAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100229983 12:92597194-92597216 AGAAAGAGAATAATGATTTTGGG - Intergenic
1100838644 12:98590613-98590635 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1101010156 12:100441149-100441171 AGAGAGAGCACAGAGAAGGTAGG - Intergenic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1101948070 12:109153358-109153380 ATAGAATGCATAATGATTGTAGG + Intronic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103042737 12:117709313-117709335 ACATATAGCCCAATGATTGTTGG - Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1107947951 13:45436725-45436747 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1108686261 13:52821408-52821430 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109272078 13:60266834-60266856 AAATGGAGCACAAGGATTGTTGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111568677 13:90049014-90049036 AGGGAGAGCAAAATGAATATGGG - Intergenic
1111569807 13:90069278-90069300 AGAGAGAGAACATTTATTTTAGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112823707 13:103366629-103366651 AAAACCAGCACAATGATTGTTGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114773112 14:25451352-25451374 AAAGAGAGAACAATGAAGGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1115986600 14:39108808-39108830 AGTGAGAGCACAAAGATTATAGG - Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117821767 14:59657590-59657612 AGAGAGAGCAGAATCAGGGTGGG + Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118699739 14:68421590-68421612 AGCGAGAGCACAAAGATTCTAGG + Intronic
1118956532 14:70488219-70488241 AGAGAGAGCACAACAATTGGAGG + Intergenic
1118984072 14:70738570-70738592 TGAGAGAGCTAAATGATTGGTGG - Intronic
1119269480 14:73289430-73289452 AGAGATGGTACAATAATTGTTGG + Intronic
1120380103 14:83766335-83766357 ACACAGAGCAGAATGAATGTAGG + Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120458208 14:84759319-84759341 ACAGAAAGCATAATGATTATGGG + Intergenic
1121893619 14:97623646-97623668 AGAGAGAGCAAAATCATGTTAGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1125275297 15:37983015-37983037 AGAGAGAGCTGAATGGTTCTAGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126856968 15:52848035-52848057 AGAGTTAGCACAAGGAATGTGGG + Intergenic
1127509313 15:59624514-59624536 AGTAAGAGCACAATAGTTGTGGG - Intronic
1128712115 15:69879737-69879759 TGAGGGAGGACAATGTTTGTTGG - Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129260206 15:74362132-74362154 AGCGAGAGCACAAAGATTCTAGG - Intronic
1129469947 15:75747348-75747370 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1129642266 15:77392965-77392987 AAAGAGAGCACACCGCTTGTGGG + Intronic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1131774241 15:95776461-95776483 AGAGAGAGAAAAAAAATTGTGGG + Intergenic
1133273268 16:4621756-4621778 AGAGAGATCACAATGGGTGGGGG + Intronic
1133713068 16:8420095-8420117 AGAGAGAGAATAATGACTGGAGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1133842450 16:9421950-9421972 TGAGAGAGGAAAATGTTTGTCGG - Intergenic
1136241527 16:28947570-28947592 AGAGAGAGTTTAATGATTGCAGG + Intergenic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1137780816 16:51096353-51096375 TGTGAGTGCACAATGTTTGTGGG - Intergenic
1138061186 16:53892105-53892127 AGACAGAACAGAATAATTGTTGG + Intronic
1138335546 16:56250012-56250034 AGAGAGAGAACAATGGTGGATGG + Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1140065491 16:71607776-71607798 GGACAGAGCAGAATGATTGCTGG - Intergenic
1141137454 16:81475601-81475623 AGTGAGAGCACAAAGATTCTAGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146080409 17:29774951-29774973 AGTGAGAGCACAACGAGTATAGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146147215 17:30430318-30430340 AGAGACAGAACAAAGATTGGTGG - Intronic
1147430645 17:40368529-40368551 ATCGAGAGCACAAAGATTCTAGG - Intergenic
1148761983 17:50009221-50009243 AGAGAGAGCAGAAAGAATGAGGG + Intergenic
1148783625 17:50134840-50134862 AGAGACGGCACAATGATGGGGGG + Exonic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150216275 17:63472180-63472202 AGAGATAGCACAAAGATTAGAGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151274046 17:73020631-73020653 TGAGAGAGAACAATGCTTTTGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155520336 18:26661498-26661520 AGAGAGACCACATTGATTTAAGG - Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1157317180 18:46602008-46602030 AGAGAGAGAACATTGTTGGTTGG + Intronic
1157698882 18:49746856-49746878 AGAGAAAACAGAATGAATGTGGG - Intergenic
1158592892 18:58792256-58792278 AGGGAGAGGACAATGATTCCGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1162700128 19:12508356-12508378 AGCAAGAGCACAAAGATTCTAGG - Intronic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1164655961 19:29922058-29922080 AGTGAGAGCACAAAGATTATAGG - Intergenic
1165351270 19:35277298-35277320 AGAGGGAGCACAAGGATGGAAGG + Intronic
1167681691 19:50926970-50926992 AGTGAGAGCACAAAGATTCTAGG + Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926445667 2:12938861-12938883 AGAGGGAGGACAATGCCTGTTGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927390522 2:22589788-22589810 AGAGAGAGCAAGATGAATATTGG + Intergenic
927474109 2:23399203-23399225 AGTGACAGCACAAAGATTCTAGG - Intronic
928450105 2:31371067-31371089 TGGGATAGCACAATGAATGTGGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928659379 2:33485496-33485518 TGAGATAGCATAATGATTTTTGG - Intronic
928664101 2:33533281-33533303 AGAGAGAGGAAGATCATTGTAGG - Intronic
928902778 2:36338433-36338455 AGAGAGACCAAAATTATTCTTGG - Intergenic
930056790 2:47258360-47258382 AGGGAGAGCACAATGTTTCAGGG + Intergenic
930139767 2:47939623-47939645 AGTGACAGCACAAAGATTATAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
934330840 2:92066520-92066542 AGAGATGGTACAATGATGGTTGG - Intergenic
934607736 2:95710270-95710292 GGAGAGAGCACACTGACTGAGGG + Intergenic
935627837 2:105185680-105185702 AGAGAGAACGGAATAATTGTTGG - Intergenic
935891172 2:107680205-107680227 AGAGAGAGCACAAAGGATGGAGG + Intergenic
936541077 2:113352150-113352172 GGAGAGAGCACACTGACTGAGGG + Intergenic
936542542 2:113363899-113363921 AGAGAGAGCACACAGTCTGTCGG - Intergenic
938214339 2:129496877-129496899 AGCTAGAGCACAAAGATTCTGGG - Intergenic
938369341 2:130759163-130759185 AGAGACAGGACAATAAGTGTAGG - Intronic
940080850 2:149799439-149799461 TGAGACAGAACAATAATTGTAGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941903896 2:170703020-170703042 AGAAAGAGCACATTGGTTTTTGG - Intergenic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942477121 2:176339166-176339188 AGTGAGAGCACAAAGATTATGGG - Intergenic
942653323 2:178191225-178191247 AGTGAGAGTACAAAGATGGTTGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943378821 2:187117555-187117577 GGAGTGAGCACAATCATTTTAGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943881247 2:193147320-193147342 ACAGAGAGTAGAATGATAGTTGG + Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945066309 2:205950235-205950257 AGCGAGAACACAAAGATTCTAGG - Intergenic
945399994 2:209369944-209369966 AGAGAGAGCAAAATGAGTTTAGG + Intergenic
945641174 2:212431888-212431910 GGAAAGAGGACAATGAATGTTGG - Intronic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168863892 20:1067663-1067685 AGAGAGAGGAAAATGATTCATGG - Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169646773 20:7819866-7819888 AGAGAGAGAATAATGACAGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170818356 20:19734389-19734411 AGAGAGAGAGAAATGATTTTTGG + Intergenic
1171470611 20:25368164-25368186 AGCAAGAGCACAAAGATTCTAGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172794989 20:37530629-37530651 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1173459457 20:43231343-43231365 AGCAAGAGCACAAAGATTCTAGG - Intergenic
1173639856 20:44593588-44593610 AGAGAGAGTAGAAGGGTTGTTGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176972189 21:15279680-15279702 AGAGAGAGAACATTGCTTGAAGG - Intergenic
1177160608 21:17544157-17544179 AGAGAAAGAAAAATCATTGTAGG + Intronic
1177271832 21:18858362-18858384 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182385457 22:29936097-29936119 AGAGATAGCAGAAGGATAGTTGG - Intronic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1182734214 22:32519675-32519697 GGAGAGTGCACCTTGATTGTTGG - Intronic
1184371914 22:44088003-44088025 AGAGAGATCACAAAGATTCAGGG - Intronic
1184382837 22:44156836-44156858 ACAGAGAGCAGAATGATTGGTGG + Intronic
1184946589 22:47808366-47808388 TGAGAGAACGCAAGGATTGTGGG - Intergenic
950011055 3:9724161-9724183 AGAGAGGGCACAAAGGTAGTGGG - Intronic
950414061 3:12858330-12858352 AGAGAGAGCAAAAGAATTGTGGG + Intronic
950749108 3:15114804-15114826 AGAAAGAGCTTAATAATTGTGGG - Intergenic
950756405 3:15176796-15176818 AGAAAGAGAAGAATGCTTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951146934 3:19238313-19238335 AGAGAGAGCACTCTTATTCTAGG - Intronic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953254291 3:41274621-41274643 AGATACAGCCCAATTATTGTGGG + Intronic
953658637 3:44873943-44873965 AGCGAGAGCACAAAGATTCTAGG - Intergenic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955604809 3:60690114-60690136 AGTGAAAGCACAAAGATTCTAGG + Intronic
956064300 3:65380532-65380554 ATAGAAAGCAGAATGATGGTTGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957464717 3:80572676-80572698 AAAAAGAGCACAATGGTAGTTGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959719553 3:109471218-109471240 AGCGAGAGCACAAAGATTCTAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960270330 3:115666960-115666982 AGAGAGAGGAAAATGACTGCTGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
962774185 3:138643406-138643428 AGTGAGAGCACAAAGATTATAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963828798 3:149984886-149984908 AGAGATAGCACAAAGATTATAGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964514433 3:157492722-157492744 AGAGAGAGCATTTTCATTGTTGG - Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965306174 3:167066421-167066443 AGCGAGAGCACAAAGATTCCAGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972295398 4:37732963-37732985 AGAGAGTACAGAATGAATGTTGG - Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973839554 4:54846971-54846993 AGTGAGTGCTCAATGAATGTTGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974285756 4:59865011-59865033 AGGGAGAGCCAAATGATTCTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979734257 4:124063076-124063098 AGTGAGAGCACAAAGATTCTAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983651262 4:170039199-170039221 AGAAAGAGCAAAATGATCATGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987273186 5:16334791-16334813 AGGCAGAGCACAAAGATTTTAGG + Intergenic
987541842 5:19265621-19265643 AGAGAGGGCAGAAAGCTTGTGGG - Intergenic
987845037 5:23272844-23272866 AGAAAGAACACAATAATTGCAGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989564872 5:42892205-42892227 AGCGAGAGCACAAAGATTATAGG + Intergenic
989980142 5:50633697-50633719 AGCAAGAGCACAAAGATTCTAGG - Intergenic
990074127 5:51821634-51821656 AGACAGAGAACAATTATTGGAGG - Intergenic
991433521 5:66572641-66572663 AGCAAGAGCACAAAGATTCTAGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992966663 5:82009488-82009510 AGCGAGAGCACAAAGATTCTAGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997289291 5:132714237-132714259 AGACAAAGCAGAATGGTTGTTGG + Intronic
999846491 5:155486674-155486696 AGTAAGAGCTCAATGAATGTTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000904633 5:166950047-166950069 AGAGACAGAACATTGATTATTGG + Intergenic
1000948655 5:167453082-167453104 AGAGAGAGCACAAGAAAAGTGGG + Intronic
1000958734 5:167573573-167573595 AGAGAGAGAACAATGAGCGAGGG - Intronic
1002307391 5:178291821-178291843 AGAGAGATGACAAGGATTTTTGG + Intronic
1002759227 6:188990-189012 AGAGGGAGCCAGATGATTGTGGG + Intergenic
1004096788 6:12563048-12563070 AGACAGAACACAATAATAGTGGG + Intergenic
1004973088 6:20934124-20934146 TGAGAGAGCAATATGATTGAAGG + Intronic
1004981058 6:21024516-21024538 AGAAAGGGCACAATTAATGTAGG + Intronic
1005089843 6:22044876-22044898 AGTGAGAGCACCAAGACTGTGGG + Intergenic
1005387234 6:25297448-25297470 AGAGAGAGTAAAATGATAGAGGG - Intronic
1005810336 6:29510382-29510404 AGAGAGAGCACATTGTCTGCAGG + Intergenic
1006564162 6:34939975-34939997 AGTGTGAGCACAATGAATTTTGG + Intronic
1007037206 6:38687024-38687046 ACAGAAAGCACAATTAATGTTGG - Intronic
1008499191 6:52163647-52163669 AGAGAGAGAACACTGGTTCTTGG - Intergenic
1008730697 6:54479387-54479409 AGAGAAAGAACAAAGATTGGGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010596402 6:77769199-77769221 AGAGAGAACATACTGATTATGGG + Intronic
1011322935 6:86116723-86116745 AGGAACAGCACAAGGATTGTGGG - Intergenic
1012848160 6:104415788-104415810 AGACAGAGCAGAAAGAGTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013456131 6:110331227-110331249 ACAGAGAGAAAAATTATTGTGGG + Intronic
1013626884 6:111947244-111947266 ATAGAGAGCAGAATGAATGGCGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015159969 6:130142190-130142212 ATATAGGGCACCATGATTGTAGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021685893 7:23185350-23185372 AGAGAAACAACAAAGATTGTAGG - Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022771315 7:33475792-33475814 AGAGCGAGAGGAATGATTGTTGG + Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023945728 7:44801508-44801530 AGCGAGAGCACAAAGATTCTAGG - Exonic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027515864 7:79140612-79140634 CAAAATAGCACAATGATTGTAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027526263 7:79272971-79272993 AGAGAGACCAAAATTACTGTAGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028068369 7:86417159-86417181 AGAGAGAACAAAATGAATCTTGG - Intergenic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029147064 7:98454002-98454024 AGCGAGACCACAAAGATTCTAGG + Intergenic
1029175887 7:98664193-98664215 AGAGAGAGTTTAATGATTGCAGG - Intergenic
1029232656 7:99084174-99084196 AGAGAAAGGAGAATCATTGTTGG - Intronic
1030204042 7:106935190-106935212 AAACAGAGAACAATGAGTGTTGG + Intergenic
1030362664 7:108611097-108611119 AGAGAAAGCACAAGGATTCTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031829746 7:126612342-126612364 AGACAGAGCATAATGAATTTAGG - Intronic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032761185 7:134944070-134944092 AGAGAGAGCAAACTCATTTTTGG + Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033760796 7:144434715-144434737 AGCAAGAGCACAACGATTATAGG + Intergenic
1033777968 7:144634150-144634172 AAAGAGAGCACAAGAATTGCTGG + Intronic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035264410 7:157683289-157683311 AGAGCTTGCACAATGATTGTCGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1040336735 8:46419881-46419903 AGCGAGACCACACTGAATGTTGG + Intergenic
1040338354 8:46427495-46427517 AGAGAGACCGCAAGGAATGTGGG + Intergenic
1040991527 8:53356302-53356324 AGAAAGGACACAATGATTCTGGG + Intergenic
1041497632 8:58504141-58504163 AGCAAGAGCACAAAGATTATAGG - Intergenic
1041732952 8:61081247-61081269 AGAGAGAGCAGAAGGAATGAGGG + Intronic
1042110693 8:65378204-65378226 AGCAAGAGCACAAAGATTATAGG - Intergenic
1042419801 8:68572928-68572950 AGAGAGCTCACAATTATTGAGGG - Intronic
1042656164 8:71099339-71099361 AGAGAGAGCACAATTTCTGATGG - Intergenic
1043039919 8:75250361-75250383 TGATAAAGCACAATTATTGTTGG - Intergenic
1043157912 8:76808740-76808762 TTATAGAACACAATGATTGTGGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043313488 8:78891811-78891833 AGAGGGAGAGCAATGGTTGTTGG - Intergenic
1043525297 8:81090149-81090171 AGAGAGAGTAGAAAAATTGTGGG - Intronic
1043574302 8:81639918-81639940 ATAGAGAGCAGAATGATGGCTGG + Intergenic
1043934393 8:86127151-86127173 AGAGAGAGAAGAATGTTTATGGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044583308 8:93843850-93843872 AGAAAGTGCTCAATGAATGTTGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044734517 8:95266198-95266220 AGAAAGAGCTCAATAAATGTTGG + Intronic
1046552843 8:115738606-115738628 AGAGAGAGCAAAACACTTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046869071 8:119184653-119184675 AGAGAGAGAAGAATGCTGGTGGG + Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048242178 8:132753530-132753552 AGAGACGGGACAATGTTTGTCGG - Intronic
1050634656 9:7598463-7598485 AGCGAGAGCACAAACATTCTAGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052434717 9:28411521-28411543 ACAGAGAGCAGAATGGTGGTTGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054941962 9:70753380-70753402 AGATTTAGAACAATGATTGTAGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055464308 9:76549171-76549193 AGTGAGAACACAAAGATTATAGG + Intergenic
1055672894 9:78625060-78625082 AGAGAAAGGAAAATGCTTGTTGG + Intergenic
1055736925 9:79340356-79340378 ACAGAGAGCACAATGTGGGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056876325 9:90336073-90336095 AGAGAGAGCACAAGAAATGCAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1058574970 9:106391040-106391062 GGAGAGACCACAATGTATGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059216114 9:112564428-112564450 AGAGAGACTACAAGGATTTTTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187782345 X:22841772-22841794 AGAGAGAACTCAATGTTAGTGGG + Intergenic
1187837224 X:23445112-23445134 AGAGAGAGCTCACTGCTTATTGG + Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188933301 X:36142069-36142091 AGAAAGGGGAAAATGATTGTTGG + Intronic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194257614 X:91653493-91653515 AGAGAGAACACAATGACCGGAGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195018337 X:100800188-100800210 AATGAGAGCACAAAGATTATAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197458736 X:126711651-126711673 AGAGTGAGCAAAATGAGTGAAGG - Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199751145 X:150819333-150819355 AGTGAGTGCACAAAGATTATAGG - Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201057814 Y:10013191-10013213 AGAGTGAGCATAATGAATGACGG - Intergenic
1201250148 Y:12049251-12049273 AGAAAGAGCTTAATAATTGTAGG - Intergenic
1201250279 Y:12050547-12050569 AGAAAGAGCTTAATAATTGTAGG - Intergenic
1201712202 Y:17004855-17004877 AGAGAGATAACAACGAGTGTTGG - Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic