ID: 1194693784

View in Genome Browser
Species Human (GRCh38)
Location X:97019842-97019864
Sequence GTCTTCTGCTAAAAAAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194693782_1194693784 21 Left 1194693782 X:97019798-97019820 CCTAGTATTAATGATAAATTTTT 0: 1
1: 0
2: 5
3: 51
4: 650
Right 1194693784 X:97019842-97019864 GTCTTCTGCTAAAAAAACTAAGG 0: 1
1: 0
2: 1
3: 11
4: 182
1194693781_1194693784 26 Left 1194693781 X:97019793-97019815 CCATTCCTAGTATTAATGATAAA 0: 1
1: 1
2: 1
3: 24
4: 279
Right 1194693784 X:97019842-97019864 GTCTTCTGCTAAAAAAACTAAGG 0: 1
1: 0
2: 1
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194693784 Original CRISPR GTCTTCTGCTAAAAAAACTA AGG Intronic
901223537 1:7597719-7597741 GTCTTATGCAAAAAAGACTGAGG - Intronic
908170041 1:61495332-61495354 CTCTTCTTCTAAGAAAAATAAGG - Intergenic
910137618 1:83991003-83991025 GTATTCAGCTTTAAAAACTAAGG + Intronic
912537537 1:110386346-110386368 GTAGTCTGCTAAATTAACTAAGG - Intronic
915796127 1:158735389-158735411 GTCTTCAGATAAAGAAACTTAGG - Intergenic
917753109 1:178072306-178072328 GTCTTCTGCAAAAAAGAATTGGG + Intergenic
918259335 1:182781409-182781431 CACTTCTGCTATAAAAACTTAGG + Intergenic
920408890 1:205742509-205742531 GTCTTGTGCTAAAAAATAAAAGG + Intronic
920961093 1:210664756-210664778 GTCTTCTGCTACAAAAAGAGGGG - Intronic
922028179 1:221772810-221772832 GCCTTCTCCCAACAAAACTAAGG + Intergenic
922108051 1:222529531-222529553 GTTTTCTCCTAAAAATACAATGG - Intronic
1063615482 10:7596506-7596528 GTCTTATGCTCAAAAACCTAGGG - Intronic
1063737799 10:8780499-8780521 CTCTTCTGCTATGAAAAATATGG - Intergenic
1072870181 10:99110780-99110802 GTCTTTTGATAAAACAACAAAGG - Intronic
1073400329 10:103251670-103251692 GCCTTCTGCTGATATAACTAAGG + Intergenic
1074089387 10:110233760-110233782 GCCTTATACTAAAAAAACTGAGG + Intronic
1076099594 10:127765093-127765115 CTCTTCTGCTAAAAAATATGTGG + Intergenic
1078461492 11:11518526-11518548 GTTTTCTACTAAAAAATCTGAGG + Intronic
1079215058 11:18502029-18502051 TTCTTCAACTAAAAAAACTAAGG - Intronic
1080128319 11:28764281-28764303 GACTTCTGAAAAAAAAATTAGGG - Intergenic
1083448147 11:62724419-62724441 GTCATCTCCTACAAAAACGAGGG + Exonic
1085780588 11:79404623-79404645 GTCTTTTTCTAAAAAAAATGAGG - Intronic
1086097197 11:83062414-83062436 GTATTCTGATAAAAAAACAAAGG - Intronic
1091503880 12:1046928-1046950 CTCTTTTCCTAAAACAACTACGG - Intronic
1092006592 12:5075387-5075409 GTCTTCTGATTACAAATCTATGG - Intergenic
1093986035 12:25534597-25534619 GTCTTCTGCTAAATACTCAAAGG - Intronic
1094200053 12:27785799-27785821 GTTTTCTTTAAAAAAAACTATGG + Intronic
1094744088 12:33323040-33323062 GTCTCATGCCAAAAAAATTAAGG - Intergenic
1096125969 12:49119819-49119841 GTCTTCAGAAAAAAAAACTCTGG + Intergenic
1096989764 12:55790566-55790588 GTCATCTGATAACAAACCTATGG - Exonic
1097402804 12:59150236-59150258 GTCTTCTGCACAAACCACTAGGG - Intergenic
1097984056 12:65764750-65764772 GTCTACTGATAAAAAAAAAAAGG + Intergenic
1098719031 12:73871030-73871052 GTCATCTCCAAAACAAACTATGG - Intergenic
1100666713 12:96762007-96762029 AATTTCTGCAAAAAAAACTAAGG + Intronic
1101672375 12:106887850-106887872 TTCTTCTTTTAAAAAAACTCAGG - Intronic
1103130129 12:118460889-118460911 TCCTTCTGCTCAAAAAACTTAGG - Intergenic
1103440705 12:120960723-120960745 CTATTCTTCTAAAAAGACTATGG + Intergenic
1104623259 12:130333984-130334006 GTTTTCTGCTTTAAAAACTTGGG + Intergenic
1107896012 13:44964655-44964677 GTCTTCTGCTAAATAGTCCAGGG - Intronic
1108917011 13:55626910-55626932 GTCTTTTGCCAAAAAATCTGGGG - Intergenic
1109288345 13:60439572-60439594 TGCTTCTGCTACAAATACTAGGG - Intronic
1110220564 13:73068265-73068287 GTCTTCTGCAAAAGACAGTAAGG - Intronic
1110737836 13:78958898-78958920 GACTTTTGATAATAAAACTAAGG + Intergenic
1110893767 13:80723362-80723384 GTCTTCAGTTAAAATAACTTAGG - Intergenic
1111889734 13:94067420-94067442 GTATTCTGCTACAAAAATTAAGG + Intronic
1112088512 13:96056009-96056031 GTATTTTGCTAAAAAGACTTAGG - Intergenic
1113199121 13:107845679-107845701 GTCTTCTCCCAAAAAGCCTAGGG - Intronic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1118259976 14:64237264-64237286 GTGTTTGGCTAAAAAAAATAAGG - Intronic
1120639655 14:86995365-86995387 ATCTGCTTCTAAAAAGACTATGG - Intergenic
1122612027 14:102991319-102991341 GTCTTCTACTGAAAAAGCAAGGG + Intronic
1123199661 14:106650515-106650537 GTCTTTTGCTTAAAAATATATGG + Intergenic
1124192203 15:27589623-27589645 TGCTGCTGCTAAGAAAACTAAGG + Intergenic
1131640071 15:94283132-94283154 GTCTGCTGTTGAAAAACCTATGG + Intronic
1131884112 15:96891324-96891346 GTCTTTTGATGGAAAAACTAGGG - Intergenic
1133660965 16:7917119-7917141 GTCTTCTGCTGAAGAAGCAATGG + Intergenic
1137881593 16:52054575-52054597 GTTTTCTGCGACAAAAGCTATGG + Intronic
1142792030 17:2274365-2274387 GTCTTCTACTCCAAAAACTCAGG + Intronic
1144999668 17:19295182-19295204 GTGTTGTGCTAAAGACACTAGGG - Intronic
1148715352 17:49711750-49711772 CTCTTCAGCTAAAAAAAGGAGGG + Intronic
1149237036 17:54604522-54604544 GTCCTCTGACACAAAAACTAGGG - Intergenic
1149442587 17:56687314-56687336 GTCTTCTGCTAAAATGGCTGAGG - Intergenic
1149498380 17:57133483-57133505 GTCTTTTGTTAAACAAATTAAGG + Intergenic
1155784336 18:29878630-29878652 GGGTTCTACTACAAAAACTATGG - Intergenic
1156005877 18:32440224-32440246 TTCTTCAGCTAAAAAAAGTAAGG - Intronic
1156225935 18:35108003-35108025 GTCTTCTTCTAAAAAAAAAAAGG + Intronic
1160446451 18:78931359-78931381 ATCTTCTTTTAAAAAAAATACGG + Intergenic
1162665170 19:12204235-12204257 GTATTCTGCTATGAAAAATAGGG + Intergenic
1163500796 19:17674977-17674999 GTTTTCAGCTAAAAAGACTGAGG + Intronic
1164463646 19:28469563-28469585 GTCTGCTAATAAAAAGACTATGG + Intergenic
1164490298 19:28705341-28705363 TTCTGATGCTAAAAAAACAATGG - Intergenic
925457443 2:4027965-4027987 GTCTACTGCTAACAAAGCAAAGG - Intergenic
925543621 2:4993531-4993553 TTCTTCGGCTAATAAAATTATGG - Intergenic
927939897 2:27096945-27096967 GTCTTCAGGTGAGAAAACTAAGG + Intronic
929371922 2:41235907-41235929 GTCTTTTGCAAAAGTAACTAGGG + Intergenic
930929396 2:56862224-56862246 GTCTACTGTTGAAAGAACTATGG + Intergenic
931038892 2:58275059-58275081 GTCTACTGCCAAAAACACTTTGG - Intergenic
934514128 2:94974198-94974220 GTCTTCTGCTTAAAAACGCATGG + Intergenic
936861367 2:117024578-117024600 GTATTCTGCTATAAAAAAGAGGG - Intergenic
936866577 2:117081657-117081679 GTCAACTGCTATAAAATCTATGG + Intergenic
937578740 2:123457311-123457333 GGGTTTTGCTCAAAAAACTAAGG + Intergenic
938044355 2:128103928-128103950 GTCTTCTGCTAAAAACTCACTGG - Exonic
939313527 2:140516548-140516570 GCTTTCTGCTATAAAAAATAAGG - Intronic
941246433 2:163103397-163103419 TTCTTCTGCTAGAAAAAATAAGG - Intergenic
941582213 2:167313258-167313280 GCCTTCTTCTATAAAAAGTAGGG - Intergenic
941629116 2:167864958-167864980 TTCTTCTGTTAAAAAAAAAAAGG + Intergenic
942697792 2:178665314-178665336 GTCCTCTGCTCTTAAAACTATGG - Intronic
942892240 2:181005321-181005343 GACTTCTGATGAAAAAACTGGGG - Intronic
945525975 2:210888241-210888263 GTCTGCTGGTGAAAGAACTATGG - Intergenic
947815166 2:233031984-233032006 GTCTTCAGCTAAAAAGGGTAGGG - Intergenic
1172986824 20:38998257-38998279 GACTTATGACAAAAAAACTATGG - Intronic
1173948422 20:46970281-46970303 GTCCTCTGCTATAGAAATTAGGG + Intronic
1174720471 20:52806456-52806478 GTTTTCTGTTTAAAAAAATAGGG + Intergenic
1175421405 20:58836561-58836583 GTCTGCTGGTAAATAAAGTATGG - Intergenic
1177559760 21:22734784-22734806 GACTTGTGATAAAAAAATTAAGG - Intergenic
1177931779 21:27294481-27294503 CTCTTCTCCTGCAAAAACTATGG - Intergenic
1182770019 22:32788075-32788097 CTCTTCTGCTCAAAACTCTATGG - Intronic
1183848633 22:40564182-40564204 GTATTCTGCTAATAGAAATAGGG + Intronic
949266235 3:2159674-2159696 ATCATCTGCAAAAAAAAATATGG - Intronic
949462667 3:4309757-4309779 GACTTCTGCTGAAACAATTAGGG - Intronic
950345878 3:12292678-12292700 GTCTCCTGCTTAAGAAAGTAAGG + Intronic
951366838 3:21793592-21793614 ATCTTCAGGTAAAAAAACTGAGG + Intronic
952734357 3:36674144-36674166 TTCTCCTGCTACAAAAACTGTGG - Intergenic
953366486 3:42349970-42349992 ATCTTTTGCTAAAAAACCCAGGG - Intergenic
953367788 3:42361482-42361504 GTTTTCTAATAAAAAAATTAAGG + Intergenic
955276113 3:57548936-57548958 ATCTTTTTTTAAAAAAACTATGG - Intergenic
958139175 3:89539261-89539283 ATATTCTGCTAAAAATACTTAGG - Intergenic
959827803 3:110820250-110820272 ATGTTCTTCTAAAAAACCTATGG + Intergenic
960168414 3:114430307-114430329 TTCTTCTGGTAAAGAAACTGAGG + Intronic
961101444 3:124202552-124202574 GACTTCTCATTAAAAAACTAGGG - Intronic
966760429 3:183413331-183413353 GTATTCTTATAATAAAACTAGGG + Intronic
967084648 3:186083218-186083240 GTCTTCTGCTATAAAAGTTTTGG + Intronic
967252486 3:187555328-187555350 ATCTTCTGCTGAGAAAACTGAGG - Intergenic
967355992 3:188572211-188572233 GACATATGATAAAAAAACTATGG + Intronic
967659587 3:192090597-192090619 ATCTTATTTTAAAAAAACTATGG + Intergenic
967782136 3:193451227-193451249 GTCTTCTGCAGAAATAACCAAGG - Intronic
971086470 4:23282214-23282236 CACTTCTGCAAAAAATACTATGG - Intergenic
972706023 4:41543732-41543754 GGTTTCTGTTAAAAAAACAAAGG + Intronic
973175435 4:47199399-47199421 GACTTCTGCTAAGATAGCTAAGG - Intronic
973724995 4:53766336-53766358 GGCTTCTGGTAGAAAAACTGTGG + Intronic
973804017 4:54507402-54507424 GTCTTCTGCTGAAAACAGAATGG + Intergenic
973979487 4:56296002-56296024 GTCTTCAGCTAAATAACCCAGGG - Intronic
973983816 4:56330095-56330117 GTCTTCTGAGCAACAAACTATGG + Intergenic
973998194 4:56481585-56481607 ATTTTCTGCTAAAAAAAAAATGG + Intronic
975454012 4:74567410-74567432 TTCTTCTTCTAAAAAAAAAAAGG - Intergenic
976064210 4:81165124-81165146 GTGTTCTGATAAGAAAACGAGGG - Intronic
978269281 4:106869319-106869341 GTCATTTGCTACATAAACTAAGG + Intergenic
979383309 4:120034417-120034439 GGCTTCTGGTAAGAAAATTAAGG + Intergenic
980858803 4:138473982-138474004 ATGTTCTGCTCCAAAAACTATGG - Intergenic
981578563 4:146229890-146229912 GTCTTGTCCTAGAAAAACAAAGG - Intergenic
982447095 4:155504836-155504858 CTCTTCTGGAAAATAAACTAGGG - Intergenic
983909082 4:173216492-173216514 GTTTTCTTTTATAAAAACTATGG + Intronic
984179656 4:176466407-176466429 GTCTTCTGTTTAATATACTAGGG - Intergenic
984709124 4:182870198-182870220 GTCTTCTGCTGGAAACAGTACGG + Intergenic
985504192 5:269583-269605 TTCTTCTGCTGATAAAACTTTGG - Intergenic
986637621 5:9838313-9838335 GGCTTCTGGGAAAAAAACCAGGG - Intergenic
988044419 5:25931715-25931737 GTCTTCAGCTTGAAAAACTGGGG - Intergenic
988468146 5:31510835-31510857 GTATTCTGCCAAATGAACTAAGG + Intronic
989435522 5:41408964-41408986 GTGTTCTGCTAAAATAGCCAAGG - Intronic
990352200 5:54930005-54930027 TGCATCTGCTAAAAAAATTAGGG + Intergenic
992930557 5:81639656-81639678 GATTTAAGCTAAAAAAACTAAGG - Intronic
994694939 5:103062444-103062466 ATCTTCTGCTAAAACATCAATGG + Intergenic
995333076 5:110967440-110967462 GTCTCCTTTAAAAAAAACTATGG + Intergenic
995693736 5:114857017-114857039 TTCTTTTGCTAGAAAAAATAGGG + Intergenic
1001619170 5:173068085-173068107 TTATTATGCTAATAAAACTAAGG - Intronic
1002534965 5:179870977-179870999 GTCTTTTGCTAAAAGCACAAGGG + Intronic
1003015008 6:2461437-2461459 TTCTTCTACTGAAAAAAGTAGGG - Intergenic
1003832676 6:10031573-10031595 GTATTATGATAAAAGAACTAAGG + Intronic
1003847354 6:10186908-10186930 GTCTTCTACTCAAGAAAATAGGG + Intronic
1007171477 6:39866970-39866992 GTGTTCTGCTGAAGAATCTATGG - Intronic
1009412785 6:63385662-63385684 GTCTAATGCTTAGAAAACTATGG - Intergenic
1011248755 6:85348109-85348131 ATCTTATGCTACAAAAAATAAGG + Intergenic
1011987747 6:93471495-93471517 GTCTTCAGCTAAAAAAAATTAGG - Intergenic
1014984532 6:127986574-127986596 GACTTCTTCTAAAAAAAGGAAGG - Intronic
1015038887 6:128692279-128692301 TTCATCTTCTAAAAAAACTCTGG - Intergenic
1016377856 6:143442172-143442194 GTGAACTGCTAAACAAACTATGG + Intronic
1016725165 6:147356416-147356438 GTATTTTGCTAAAATAACTTTGG + Intronic
1016853962 6:148647927-148647949 GGCTGCTGCTAAAAAAGCTGAGG - Intergenic
1018115979 6:160585821-160585843 CTCTTCTTCTCAAAAAACAACGG + Intronic
1020362644 7:7345682-7345704 GACTTCTTGTAAAAAAACAATGG - Intergenic
1023195808 7:37637745-37637767 GTCTTAAGCAAAAAAAACAAAGG - Intergenic
1024220841 7:47285221-47285243 GTCTTCAGCTATAAACAATATGG - Intronic
1026432963 7:70366557-70366579 GTCTTCTGCTTAAAAACCTCTGG - Intronic
1028693230 7:93677610-93677632 GTTTTCTGCTAAAGCAAGTAGGG - Intronic
1030789178 7:113702704-113702726 GTCTTGTTCTAAAACAGCTATGG - Intergenic
1034392070 7:150794558-150794580 GTCTTCAGCTTGAAAAATTAGGG - Intronic
1034503944 7:151470570-151470592 ATCTTCTGCTAAAGAAAATCAGG - Exonic
1035217954 7:157384243-157384265 GTATTCGTCTCAAAAAACTATGG - Intronic
1036483716 8:9160992-9161014 GTATTATGGTAATAAAACTAGGG - Intronic
1037753310 8:21696423-21696445 GTCTACTGCTTAACAAAATAAGG + Intronic
1038617242 8:29105943-29105965 TTCTTCTGTTAAGAAAACTCTGG - Intronic
1039239044 8:35534535-35534557 GTCTTCTGCTTGAGAAACTTTGG + Intronic
1041477762 8:58284731-58284753 GTATTCTGATGAATAAACTATGG + Intergenic
1043193429 8:77256752-77256774 GTTTTCTGGTAAAAAGATTATGG - Intergenic
1044909940 8:97046266-97046288 GTCTTCTGGAAAAAAAAAAAAGG - Intronic
1045669983 8:104540079-104540101 GTCCTCTGCTAAATAAGGTAAGG + Intronic
1046454001 8:114435439-114435461 CTCTACTGCTACAAAACCTATGG + Intergenic
1047332606 8:123905532-123905554 TTCTTCTGCTACAAAAAGTGGGG - Intronic
1050235283 9:3571596-3571618 ACCTTCTGCTTAAAAAACAATGG - Intergenic
1050853250 9:10316338-10316360 GTCTTCTGTTACTATAACTAAGG - Intronic
1051250725 9:15156268-15156290 GTCTTCTGATAAAACAATTAGGG - Intergenic
1054963870 9:70999866-70999888 GACTTCTGCTAAACACACTGTGG - Intronic
1055325474 9:75123712-75123734 GTCTTCTTCTAAAGAAACTAGGG - Intronic
1055398095 9:75894376-75894398 CTCTTCTGTTAAAAAAAAGATGG + Intronic
1059966412 9:119618902-119618924 GTCTTCAGCTAGAGAAACTGAGG + Intergenic
1059993724 9:119889423-119889445 ATCTTAAGCTAAAAAAACTGAGG + Intergenic
1188692828 X:33151450-33151472 GTCTTCTTTTAAAAATACAAAGG + Intronic
1188695657 X:33187575-33187597 GTCCTTTTCTAAAAAAAATAAGG + Intronic
1189139712 X:38589786-38589808 GTTTTCTGCAACAAAAACAATGG - Intronic
1191012836 X:55778566-55778588 GTCTACTGCTAAAAGAAATAAGG + Intergenic
1194693784 X:97019842-97019864 GTCTTCTGCTAAAAAAACTAAGG + Intronic
1195596591 X:106698133-106698155 GTCTTCTGCTTGAATAACTCAGG - Intronic
1197480378 X:126977008-126977030 TTCTTCTCTTTAAAAAACTATGG - Intergenic
1197528406 X:127591631-127591653 GTCTAATGTTAAGAAAACTATGG + Intergenic
1201590332 Y:15607832-15607854 GTCCTTTGCTATACAAACTATGG - Intergenic