ID: 1194709720

View in Genome Browser
Species Human (GRCh38)
Location X:97220539-97220561
Sequence ATACCAGGGTGGGGCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 269}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194709702_1194709720 25 Left 1194709702 X:97220491-97220513 CCACCATCTGCTCCCCCACCACC 0: 1
1: 0
2: 10
3: 199
4: 2167
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709703_1194709720 22 Left 1194709703 X:97220494-97220516 CCATCTGCTCCCCCACCACCCCA 0: 1
1: 0
2: 16
3: 283
4: 3308
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709706_1194709720 11 Left 1194709706 X:97220505-97220527 CCCACCACCCCATCGCAGATTAC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709707_1194709720 10 Left 1194709707 X:97220506-97220528 CCACCACCCCATCGCAGATTACA 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709708_1194709720 7 Left 1194709708 X:97220509-97220531 CCACCCCATCGCAGATTACAGTG 0: 1
1: 0
2: 0
3: 4
4: 178
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709705_1194709720 12 Left 1194709705 X:97220504-97220526 CCCCACCACCCCATCGCAGATTA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709711_1194709720 3 Left 1194709711 X:97220513-97220535 CCCATCGCAGATTACAGTGGAAT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709710_1194709720 4 Left 1194709710 X:97220512-97220534 CCCCATCGCAGATTACAGTGGAA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709712_1194709720 2 Left 1194709712 X:97220514-97220536 CCATCGCAGATTACAGTGGAATG 0: 1
1: 0
2: 1
3: 16
4: 127
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1194709704_1194709720 13 Left 1194709704 X:97220503-97220525 CCCCCACCACCCCATCGCAGATT 0: 1
1: 0
2: 1
3: 19
4: 278
Right 1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194709720 Original CRISPR ATACCAGGGTGGGGCCAGAG GGG Intronic
901131272 1:6963383-6963405 AAAACAGGGTGGGGCCCGATTGG - Intronic
901374256 1:8826265-8826287 AGGCCAGGGTGGGGCCTGAAAGG - Intergenic
902157841 1:14503945-14503967 GTACAAGGGTGAGGCAAGAGAGG + Intergenic
903999133 1:27328466-27328488 AGACAATGGTAGGGCCAGAGTGG - Intronic
904419515 1:30382615-30382637 ACCCCAGTGTGGGGCCATAGTGG + Intergenic
905029886 1:34874992-34875014 ATGCCAAGGTGGGGCTAGGGTGG + Intronic
906243085 1:44254323-44254345 TTAGGAGGCTGGGGCCAGAGTGG - Intronic
906534363 1:46543571-46543593 AGAGCAGGGCGGGGTCAGAGTGG + Intergenic
909400874 1:75229229-75229251 AGACCATGGTGAGGCAAGAGTGG - Intronic
911697390 1:100906409-100906431 ATACCAGGCTGAGGACAGTGGGG - Intronic
912395994 1:109344408-109344430 AGTCCAAAGTGGGGCCAGAGGGG - Intronic
912450102 1:109763384-109763406 ACACCAGGGTGGGCCCTGTGGGG + Intronic
914443034 1:147723587-147723609 ATTCCAGGATGGGGCCAGTTGGG - Intergenic
916577511 1:166080874-166080896 ACACAAGGCTGGGGTCAGAGGGG + Intronic
919973227 1:202594141-202594163 ACACCAGTGTGGAGCCAGTGTGG - Exonic
920595707 1:207267799-207267821 AAACCAGGGTGAGGCAAGTGAGG + Intergenic
921292262 1:213669904-213669926 ATTCCAGGGGAGGGCCAGACTGG - Intergenic
1064019417 10:11797222-11797244 AGACAAGGGTAGGGCCAGAGGGG - Intergenic
1067070130 10:43125071-43125093 TTCCCAGTGTGGGGCCACAGTGG + Intronic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1067898438 10:50211796-50211818 AAACTGGGGTGGGGACAGAGTGG - Intronic
1068917807 10:62451697-62451719 TGAGCTGGGTGGGGCCAGAGAGG - Intronic
1070664224 10:78332197-78332219 ATACCAAGGAGGAGGCAGAGAGG - Intergenic
1071044817 10:81361140-81361162 CTACCAGGCTGGAGCCACAGAGG + Intergenic
1072816771 10:98517274-98517296 ATAGCTGGGTGGGGCATGAGGGG - Intronic
1072914728 10:99530925-99530947 ATTCCGAGGTGGGGGCAGAGGGG - Intergenic
1074603333 10:114936518-114936540 ATACCAGCTTGGGGGCACAGGGG - Intergenic
1075698903 10:124455800-124455822 ATACAAGGGTGGGGGCCCAGGGG - Intergenic
1075855877 10:125629908-125629930 ATACCAGGGTTAGGTCTGAGAGG + Intronic
1075863155 10:125695389-125695411 AGACCAGGGTTGGGTCACAGGGG + Intergenic
1075959026 10:126550955-126550977 ATAACAGGGTGAGGACAGAAGGG + Intronic
1075960838 10:126566769-126566791 GGACCAGGGAGGGGCAAGAGCGG + Intronic
1076907346 10:133369655-133369677 CTTCCAGGGTGGGGGAAGAGAGG - Intronic
1077337883 11:2013594-2013616 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1077628911 11:3797631-3797653 ATAACAGGGTCGACCCAGAGTGG - Exonic
1080311195 11:30894639-30894661 ATGCAAGGCTGGGGCCAGTGTGG - Intronic
1080754165 11:35179510-35179532 ATACCTTGGTGGGGAGAGAGGGG + Intronic
1083273692 11:61585191-61585213 ATGCCAGGTAGAGGCCAGAGGGG - Intergenic
1084956065 11:72692326-72692348 ATGCCGGGGTGGGACGAGAGAGG - Intronic
1089307089 11:117533483-117533505 ATACCAGGATGGGGACAAGGAGG + Intronic
1089568854 11:119389091-119389113 AGACCACGATGGGGCCAGTGAGG - Intergenic
1090061705 11:123469326-123469348 AGACTGGAGTGGGGCCAGAGTGG + Intergenic
1091218511 11:133917850-133917872 ATACCAGAGGGGCCCCAGAGAGG + Intronic
1091251312 11:134146505-134146527 AGAGGAGGGTGGGGGCAGAGAGG + Intronic
1202820867 11_KI270721v1_random:68776-68798 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1091405840 12:209033-209055 ATAACCGGGTGAGGGCAGAGAGG - Intronic
1091782499 12:3222816-3222838 ATCCCAGGGTGGGACCTGGGGGG - Intronic
1092069475 12:5621155-5621177 ATGCGGGGGTGGGGCAAGAGTGG - Intronic
1093894909 12:24563860-24563882 AAACCAGGGTGGGGCGGGGGCGG + Intergenic
1094503577 12:31041508-31041530 GTACCAGGGAGGTGGCAGAGAGG - Intergenic
1103226640 12:119293441-119293463 ATACCAGAGTGGAGCATGAGGGG + Intergenic
1103878023 12:124143952-124143974 ATTCCTGGGAGGGGCCAGTGAGG + Intronic
1103908123 12:124337703-124337725 ATGCCAGGGGGCGGCCAGGGTGG + Intronic
1104363907 12:128159602-128159624 ATTCCAGGGTTGGGACACAGTGG - Intergenic
1104574901 12:129957906-129957928 ACACTGGGGTGGGGCCACAGAGG + Intergenic
1104997051 12:132664636-132664658 GCACCAAGGTGGGGACAGAGAGG - Intronic
1105456723 13:20547872-20547894 ATGCCAGGGAGGTGCCAGGGAGG - Intergenic
1105787158 13:23760561-23760583 ATGCCAGGGTGTGGGCACAGAGG + Intronic
1109552470 13:63921344-63921366 ACACCAGTGTGGGGTTAGAGTGG + Intergenic
1112030789 13:95454531-95454553 ACAGCAGGGTGGGGAGAGAGGGG - Intronic
1114459972 14:22880085-22880107 ATACCAGGGCTGGGCCACGGTGG + Exonic
1115753612 14:36513832-36513854 TTCCCAGGCTGGGGCCAGGGTGG + Intergenic
1117195502 14:53336190-53336212 TTCCCAGGGTGGGGACTGAGTGG + Intergenic
1119418996 14:74494832-74494854 TGAACAGGGTGGGGCAAGAGTGG + Exonic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119720701 14:76888301-76888323 AGATGAGGGTGGGGCCGGAGTGG - Intergenic
1120549756 14:85855697-85855719 AAACCAGGGTGGGGGCGGTGGGG + Intergenic
1121891940 14:97602636-97602658 ACACTAGGGTGGGGCCAGGAAGG + Intergenic
1122344367 14:101049455-101049477 ATCCCAGGGTTGGGGCAGGGAGG - Intergenic
1122778085 14:104131622-104131644 GAGCCAGGGTGGGGCCAGTGAGG + Intergenic
1122802452 14:104238474-104238496 AGCCCAGGACGGGGCCAGAGAGG - Intergenic
1123114685 14:105889410-105889432 ATACCAGGGCCGGGTCTGAGAGG + Intergenic
1123116849 14:105898817-105898839 ATACCAGGGCTTGGCCTGAGAGG + Intergenic
1124181790 15:27482905-27482927 AAAGCATGGCGGGGCCAGAGTGG - Intronic
1124399115 15:29333194-29333216 AAACCAGGGAGAGGCCAGAGAGG + Intronic
1124800031 15:32823487-32823509 ACACCAAGGTGGGCCCAAAGAGG + Intronic
1125553408 15:40564912-40564934 ATTCCGGGGCCGGGCCAGAGTGG + Exonic
1128335798 15:66785123-66785145 AGGCCAGGGTGGGGCCAGTGAGG - Intergenic
1130354801 15:83119378-83119400 AAACCAGGGTCTGGCCACAGAGG - Intronic
1130788298 15:87124130-87124152 AGAATAGGGTGGAGCCAGAGTGG + Intergenic
1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG + Intergenic
1132615493 16:839476-839498 ATAACTGGGCAGGGCCAGAGTGG - Intergenic
1132654699 16:1036900-1036922 AGATCAGGGTGGAGCCAGTGTGG - Intergenic
1133562685 16:6964536-6964558 ATGCCTGTGTGGGGCCAGTGAGG + Intronic
1133883361 16:9803940-9803962 AGGCAAGGATGGGGCCAGAGCGG + Intronic
1134314727 16:13108123-13108145 AAAGCAGGGTGGGGCCGGAGGGG - Intronic
1135347393 16:21700816-21700838 CCACCAGGGTGGGGCCACACTGG + Intronic
1137463296 16:48685605-48685627 ATAGCAGGGTGGAGCTAGGGAGG + Intergenic
1139351899 16:66342342-66342364 GGACCAGGGTGAGTCCAGAGAGG - Intergenic
1140021397 16:71242442-71242464 ATACCTGTGTGGGCACAGAGAGG + Intergenic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142744751 17:1950258-1950280 ATGCCAGGATGGGGCCCGACAGG + Intronic
1143479601 17:7220695-7220717 AGAGCTGGGTGGGGCCAGGGTGG + Intronic
1143618488 17:8067681-8067703 ATACTTGGGTGGGGGAAGAGGGG + Intergenic
1144704944 17:17362217-17362239 AAAACAGTGTGGGGCCAGAGAGG - Intergenic
1144787880 17:17841904-17841926 GTGCCAGGCTGGTGCCAGAGGGG - Intergenic
1146289581 17:31598043-31598065 AGACCAGCCTGGGGCCACAGTGG + Intergenic
1147324187 17:39662587-39662609 AGACCAGGGTGGGGCCGGGCTGG - Intronic
1147332292 17:39706108-39706130 ATACCAGGCTGGGGTCCAAGTGG + Intronic
1147451827 17:40510471-40510493 ATGCCGCGGTGGGGCCAGGGAGG - Intergenic
1147537168 17:41328437-41328459 ATCCCAGGGTGTGCCCAGACTGG + Intergenic
1147571963 17:41576881-41576903 ATCCCCAGGTGGGGCCAGGGAGG + Intergenic
1147907358 17:43832030-43832052 AGACCAGGCTGTGGACAGAGAGG + Intronic
1148481201 17:47960498-47960520 TTACCAGGGAGGGGCCAGCCTGG + Intergenic
1148790032 17:50167760-50167782 ATCACAGGGGTGGGCCAGAGTGG + Intronic
1148845879 17:50529519-50529541 ATAGGAGGGAGGGGCCAGAAGGG + Intronic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1151943570 17:77307212-77307234 TGAGCTGGGTGGGGCCAGAGCGG - Intronic
1152441252 17:80311610-80311632 ATACCTGGGAAGGGCCAGGGCGG - Intronic
1152650055 17:81488507-81488529 AGACCAAGGCAGGGCCAGAGGGG - Intergenic
1153293010 18:3520160-3520182 ACACTAGGGTGGGGGCAGAAAGG - Intronic
1158535285 18:58302990-58303012 AGACTAGGGTGAGGCAAGAGAGG + Intronic
1160955073 19:1687512-1687534 AAACCACGGAGGGGTCAGAGAGG + Intergenic
1161382117 19:3970971-3970993 AGGGCTGGGTGGGGCCAGAGCGG - Exonic
1161471003 19:4456829-4456851 TTACCCGGGAGGGGCCTGAGAGG - Intronic
1162082286 19:8225341-8225363 GTAGTAGGGTGGGGACAGAGAGG + Intronic
1162297561 19:9823823-9823845 ATCCCAAGATGGGGCCAGTGGGG + Intronic
1162346335 19:10120033-10120055 GTACCAGAGTAGGGCCAGCGGGG + Intergenic
1163255450 19:16153327-16153349 CTACTGGGGTGGGGCCGGAGGGG - Intronic
1163266835 19:16226960-16226982 ACAGCAGGGCGGGGGCAGAGGGG + Intronic
1163322213 19:16581460-16581482 ATACCAGGGTGAGGTCAGCAGGG - Intronic
1163621595 19:18364045-18364067 ATCCCAGGGTGGCCCCAGAAAGG - Exonic
1164179535 19:22807086-22807108 ACAGCAGGGTGGGGGCAGTGGGG + Intergenic
1164703321 19:30301864-30301886 TTACCAGGCTGGGTGCAGAGAGG + Intronic
1165094622 19:33403376-33403398 AGCCCAGGGTGGAGCCAAAGAGG - Intronic
1165261247 19:34620512-34620534 ACACCAGGGTGGGGGGAGGGGGG + Intronic
1166071929 19:40393007-40393029 CTTCCTGGGTGGGGCCAGAGTGG + Intergenic
1166872922 19:45882008-45882030 GTGCCAGGGTGGGGCCAGGGTGG - Intergenic
1167172053 19:47839775-47839797 GTCCCACGGAGGGGCCAGAGAGG - Exonic
1167272940 19:48516677-48516699 ATTCCAGGCAGGGGCCACAGAGG + Intergenic
1167830589 19:52018226-52018248 ATACCACTTTGGGGTCAGAGAGG + Intronic
925422482 2:3724336-3724358 ATCCCAGGGAGGTGCCAGAGTGG + Intronic
925822659 2:7815591-7815613 AGTCCATGGTGGGGGCAGAGAGG - Intergenic
925988425 2:9234546-9234568 AGACCAGGGAGGGGACAGATGGG + Intronic
926732160 2:16043856-16043878 ATACCAGGATGGGGGCAGATGGG - Intergenic
927461704 2:23305001-23305023 GTACCAGGGTGGGGGAAAAGAGG - Intergenic
927491118 2:23521560-23521582 ACACCAGGGAGGAGGCAGAGAGG - Intronic
930549536 2:52815112-52815134 ATCCCAGGGTGGGGCAAGATGGG + Intergenic
931638859 2:64363931-64363953 AGGGCAGGGTGGGGCTAGAGGGG - Intergenic
933244662 2:79961992-79962014 ATACCTGGGGGTGGCTAGAGTGG + Intronic
935692034 2:105740651-105740673 AAACCAGGAAGGGGCTAGAGAGG + Intergenic
936911299 2:117596819-117596841 CTACCAGGGTGGGTACAGAAAGG + Intergenic
940653237 2:156458160-156458182 ATCACAGGGTGGGGAGAGAGAGG + Intronic
941642137 2:167999874-167999896 CTACCTATGTGGGGCCAGAGTGG - Intronic
942042200 2:172078438-172078460 AGACAGGGGTGGGCCCAGAGGGG + Intronic
945185711 2:207137400-207137422 ATACCAGGATGGGCCCACATAGG - Intronic
947848129 2:233262238-233262260 AGACCAGGGTGGGAGCAGTGAGG - Intronic
948024319 2:234764930-234764952 ATCCCAGAGTGGGGACAGGGAGG - Intergenic
948865818 2:240774273-240774295 AGACCAGGTTGTGCCCAGAGGGG + Intronic
1171495429 20:25551633-25551655 AAACAAGGGTGGGGGCAGGGAGG + Intronic
1172221118 20:33275895-33275917 AGCCCAGGGCAGGGCCAGAGAGG - Intronic
1172425368 20:34852151-34852173 CTACCAGGCTGGGTGCAGAGTGG + Exonic
1173445100 20:43110512-43110534 GTAACAGGGAGGGGACAGAGGGG + Intronic
1174061553 20:47836552-47836574 ATTCCAGCGTGGGGACACAGAGG - Intergenic
1174069972 20:47892773-47892795 ATTCCAGCGTGGGGACACAGAGG + Intergenic
1174156416 20:48518454-48518476 ATTCCAGCGTGGGGACACAGAGG - Intergenic
1174540903 20:51288562-51288584 AAGCCAGGGAGGGGCCATAGAGG - Intergenic
1175367566 20:58466608-58466630 TCACAAGGGTGGGGCCACAGCGG - Intronic
1175826582 20:61939500-61939522 TCACCAGGGTGGGGGTAGAGGGG - Exonic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1180701871 22:17785604-17785626 GGCCCAGGGTGGGGCCAGGGTGG - Intergenic
1180951333 22:19721988-19722010 AGACGTGGGCGGGGCCAGAGGGG - Intronic
1180995808 22:19964643-19964665 AGAGCAGGCTGGGCCCAGAGCGG - Intronic
1181964145 22:26645033-26645055 TGAACAGGGTGGGGCAAGAGTGG - Intergenic
1182357709 22:29729792-29729814 AGGCCAGGGTGGGGACAGGGTGG - Exonic
1182770456 22:32792032-32792054 ATACCAGGGTGTGGCCCCAGGGG - Intronic
1183038020 22:35154904-35154926 ATACATGGGTGCGGACAGAGGGG + Intergenic
1183072062 22:35403171-35403193 ATAGCAGGGTGGGGCAGGAAGGG - Intronic
949831311 3:8217482-8217504 ATACCAGGGTGGGTCCAGATTGG - Intergenic
950118900 3:10468704-10468726 GGACCAGGGTGAGGCCAGTGAGG + Intronic
950219977 3:11187104-11187126 AGAGGAGGCTGGGGCCAGAGGGG + Intronic
950536812 3:13583618-13583640 GTACCAGGGAGAGGCCTGAGGGG - Intronic
953390463 3:42530951-42530973 CTTCCAGGCTGGGGACAGAGGGG + Intronic
954212278 3:49104587-49104609 AAACCAGGCCGGGGGCAGAGGGG + Intronic
955444654 3:58996892-58996914 ACACCGGGGTGGAGCCACAGAGG + Intronic
959531627 3:107440294-107440316 GTCCCAGAGTGAGGCCAGAGTGG + Intergenic
960047286 3:113210929-113210951 ATCCCAGGATGGAGCCAGGGAGG - Intergenic
961511157 3:127404623-127404645 ATGCCTGGTTGGGCCCAGAGGGG + Intergenic
961647359 3:128399800-128399822 AGACCCGGCTGGGGACAGAGAGG - Intronic
961678609 3:128583753-128583775 ATTCCAGGGTGGAGACAGGGTGG + Intergenic
961886993 3:130102978-130103000 GCAGCAGGGTGAGGCCAGAGAGG + Intronic
962268156 3:133958167-133958189 ATCCCAGGGTGAGGTCAGGGTGG + Intronic
962342488 3:134597092-134597114 AAAGCAGTGTGAGGCCAGAGTGG + Intergenic
964845597 3:161041241-161041263 AAGCCAGGGCGGGGCCAGTGGGG - Intronic
966766669 3:183469277-183469299 AGACCAGGGTGTGCCCAGTGAGG - Intergenic
966878707 3:184337838-184337860 GAACCAGGCTGGGGCCAGACAGG + Intronic
967050803 3:185782808-185782830 ATCCCAGGGTGGGGACTGGGAGG + Intronic
967104399 3:186243651-186243673 GTACCAGTATGGGGCCTGAGCGG - Intronic
967356129 3:188573778-188573800 TGACCAGGGGAGGGCCAGAGAGG + Intronic
967469072 3:189842014-189842036 AAACCAGTTTGGGCCCAGAGGGG + Intronic
968086484 3:195876240-195876262 GTACCAGGCTGTGGGCAGAGGGG - Intronic
968092461 3:195907776-195907798 TCCCCAGGGTGGGGCCACAGAGG + Intronic
968439982 4:618432-618454 ATGCCAGGGTGGGAGAAGAGGGG + Intergenic
969103372 4:4786642-4786664 ATTCCTGGGAGGGGGCAGAGGGG + Intergenic
971333855 4:25704753-25704775 AGACTAGGGTGAGGCAAGAGAGG - Intergenic
973717315 4:53690080-53690102 AGACCTGGGTGGGGGCTGAGAGG - Intronic
981803720 4:148688337-148688359 ATAGCAGGTTGCTGCCAGAGGGG - Intergenic
982026698 4:151258816-151258838 ATCCCAGGGAGAGGCCAGTGGGG - Intronic
984529605 4:180901040-180901062 GTCCCAGGGTGGGGCCACACGGG - Intergenic
985134998 4:186777787-186777809 AAGACAGGGTGGGGCAAGAGGGG - Intergenic
985630506 5:1011543-1011565 ATGCCTGGCTGGGGCCAGCGAGG + Intronic
985881576 5:2642312-2642334 CTGCCATGGAGGGGCCAGAGTGG + Intergenic
987607114 5:20151147-20151169 CTACCAGGGTGGGGAGAGAAAGG - Intronic
988514951 5:31896135-31896157 ATACCTGGGAGGTGTCAGAGAGG - Intronic
989033760 5:37147921-37147943 ATACTAGGATGGGGCAAGTGTGG - Intronic
994222902 5:97217112-97217134 AGACTAGGGTGAGGCAAGAGAGG + Intergenic
999334169 5:150700817-150700839 ATACCGGGGAGGAGCCAGCGCGG - Intronic
1001264309 5:170261605-170261627 ACACCAAGGTGGGCCCTGAGAGG - Intronic
1002383559 5:178848828-178848850 AGACCAGTGTAGGGCCAGAAAGG + Intergenic
1003494320 6:6650880-6650902 ATACCAGAGTGGGGAGGGAGAGG - Intronic
1003603056 6:7535866-7535888 AGATCATGGTGGTGCCAGAGTGG - Intergenic
1004604932 6:17185075-17185097 AAAGCAGGGTGGGGCCGGGGTGG + Intergenic
1006582250 6:35083843-35083865 CTTCCAGGGTGGGGGCAAAGTGG - Intronic
1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG + Intronic
1010176207 6:73031006-73031028 ACTTCAGGGTGGAGCCAGAGTGG - Intronic
1010475861 6:76286556-76286578 AGACCAGCCTGGGGCCAAAGGGG - Intergenic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1011164580 6:84431812-84431834 TTCCCTGGGTGGGGCCTGAGAGG - Intergenic
1013192462 6:107815235-107815257 ATACAATGCTGGGGGCAGAGTGG + Intronic
1014863994 6:126505804-126505826 ATCCCAGGGTGGGGAAAGGGCGG + Intergenic
1015126915 6:129765174-129765196 ACACCTGGGTGGGACCTGAGTGG + Intergenic
1016809685 6:148247845-148247867 TTCCCAGGGAGGGGCCAGAGTGG - Intergenic
1017204092 6:151786335-151786357 AAACCGGGGTGGGGCAGGAGAGG - Intronic
1018986716 6:168643404-168643426 ATACCAGGGTGTGTCGAGTGGGG - Intronic
1019746048 7:2700883-2700905 ATGCCAGGGTGGAGGCAGGGAGG + Intronic
1019769726 7:2876217-2876239 GCACCAGGGAGGGGCCGGAGTGG - Intergenic
1019816777 7:3206873-3206895 ACACAAGTGTGGGGCCAGATTGG + Intergenic
1023888585 7:44377234-44377256 GGAGCAGGGTGGGGACAGAGTGG - Intergenic
1024908054 7:54410611-54410633 AGGCCAGGCTGGGTCCAGAGGGG - Intergenic
1025232889 7:57214524-57214546 ATTCCAGTGTGGGGACACAGAGG + Intergenic
1026141652 7:67711999-67712021 AGAGCAGGGTGAGGCCAGATGGG + Intergenic
1029303889 7:99604669-99604691 AGAACAGGGTGGGAGCAGAGAGG + Intronic
1029438510 7:100575183-100575205 AGACCAGAGGGGGGCCAGAGGGG + Exonic
1029730587 7:102435409-102435431 ACACCGGGGAGGGGACAGAGCGG - Intronic
1029797778 7:102913082-102913104 AAACCTGGGTGCAGCCAGAGAGG + Exonic
1029880626 7:103805832-103805854 ATAACAAGGAGGGGCTAGAGAGG + Intronic
1029933299 7:104396451-104396473 AAAGCAGAGTGGGGCCAGTGAGG + Intronic
1030084232 7:105803378-105803400 ACATCAGGGTGGGGCCAGCAGGG - Intronic
1031081011 7:117256939-117256961 AACCCAGGGTGGGTCCAAAGGGG + Intergenic
1032269170 7:130388040-130388062 TTGCCTGGATGGGGCCAGAGAGG - Exonic
1032567062 7:132957369-132957391 ATACAATGGTGGGGCCAAACTGG + Intronic
1033042835 7:137933861-137933883 GTGCCAGGATCGGGCCAGAGTGG + Intronic
1033346039 7:140526332-140526354 GGACCAGGGTGGGGCAAGTGAGG + Intronic
1034338377 7:150337696-150337718 AGACGAGTGTGGGGGCAGAGAGG - Exonic
1035605718 8:928876-928898 ACACCAGGGTAGGGGCAGGGTGG + Intergenic
1036809100 8:11854911-11854933 TTACCTAGGTGAGGCCAGAGAGG + Intronic
1037019496 8:13951972-13951994 AGATCTGGGAGGGGCCAGAGTGG - Intergenic
1037659719 8:20916347-20916369 GCACCAGGGTGGTGGCAGAGAGG - Intergenic
1037883031 8:22582063-22582085 AAGCCAAGGTGGGGCCAGGGTGG + Intronic
1040478987 8:47806349-47806371 AAAGCAGGGTGTGGCCAGAAGGG - Intronic
1040564502 8:48553601-48553623 ACAGCAGGCAGGGGCCAGAGAGG + Intergenic
1040584016 8:48722991-48723013 ATAGCAGGGTGGGGCAAAATGGG + Intronic
1040868583 8:52076807-52076829 ATACCAGGGGAGGGGGAGAGGGG - Intergenic
1041566466 8:59284702-59284724 ATAACAGGGTGGCCCCAGAGTGG + Intergenic
1041779693 8:61564067-61564089 AGGACAGGGTGAGGCCAGAGAGG + Intronic
1042531726 8:69822609-69822631 ATCCTAGGGTGTGGGCAGAGAGG - Intronic
1047803177 8:128331047-128331069 ACAGCAAGGAGGGGCCAGAGGGG + Intergenic
1048440364 8:134455165-134455187 ATACCAGCCTGGAGCTAGAGCGG + Intergenic
1048440373 8:134455213-134455235 ATACCAGCCTGGAGCTAGAGCGG + Intergenic
1048440382 8:134455261-134455283 ATACCAGCCTGGAGCTAGAGTGG + Intergenic
1048440391 8:134455309-134455331 ATACCAGCCTGGAGCTAGAGCGG + Intergenic
1049241817 8:141541659-141541681 ATGCCTGGGTGGGGCCAGCCAGG + Intergenic
1049654127 8:143790308-143790330 AGGCCAGGGTGGGGCTAGGGAGG - Intergenic
1049741871 8:144244824-144244846 CTACCAGGGTGGTGCTAGGGTGG + Intronic
1049753202 8:144295509-144295531 GGATCAGGGTGAGGCCAGAGGGG + Intronic
1051468795 9:17411458-17411480 CTATCAGGGTGATGCCAGAGAGG + Intronic
1056600803 9:88045332-88045354 ATACCAGGGTCAGTTCAGAGTGG - Intergenic
1058555040 9:106158215-106158237 ACACCAGGATGGGGCAGGAGTGG + Intergenic
1060316990 9:122521038-122521060 ATACCAGGGTGGTGGCTGCGTGG + Intergenic
1060817136 9:126640882-126640904 ATAGCAGGGTGGGGTCAGAGGGG + Intronic
1060891225 9:127189794-127189816 AACCCAGCGAGGGGCCAGAGCGG + Intronic
1061273545 9:129557388-129557410 GTCCCAGGGTGGGGACAGGGTGG + Intergenic
1061388050 9:130301923-130301945 AGACCAGGCTCGGGCCAGGGAGG + Intronic
1061989928 9:134153318-134153340 AGCCCAGGGTGGGGACGGAGGGG + Intronic
1062035144 9:134379639-134379661 ACCGCAGGGTGGGGTCAGAGAGG - Intronic
1062185433 9:135215855-135215877 ATGCAAGGGAGTGGCCAGAGAGG + Intergenic
1190331281 X:49236981-49237003 GTACCAGGGTCGGGGCAGGGAGG - Intronic
1190905956 X:54728613-54728635 ATTCCTGGGTGGAGCCTGAGAGG - Intergenic
1192363306 X:70452538-70452560 TTTGCAGGGTGGGGCCCGAGAGG + Intronic
1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG + Intronic
1195376392 X:104231953-104231975 ATAACAGGGTGGGGGAAGACGGG - Intergenic
1195681017 X:107546697-107546719 ATAACCTGGTGGGGACAGAGGGG + Intronic
1197633193 X:128885719-128885741 GTACCAGGGTGGTGGGAGAGGGG + Intergenic
1199577990 X:149333265-149333287 CTACTAGGGTGGGGCAGGAGAGG + Intergenic
1200059594 X:153478360-153478382 ACTGCTGGGTGGGGCCAGAGGGG - Intronic
1200142742 X:153909966-153909988 ACACTAGGGTGGGGACAGGGTGG + Intronic
1201251631 Y:12064156-12064178 ATACAGAGATGGGGCCAGAGAGG + Intergenic