ID: 1194711756

View in Genome Browser
Species Human (GRCh38)
Location X:97244388-97244410
Sequence TTACTATTGTGACCTAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194711753_1194711756 -5 Left 1194711753 X:97244370-97244392 CCCTTTTTACTAGTGCCATTACT 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 70
1194711752_1194711756 -4 Left 1194711752 X:97244369-97244391 CCCCTTTTTACTAGTGCCATTAC 0: 1
1: 0
2: 1
3: 15
4: 132
Right 1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 70
1194711754_1194711756 -6 Left 1194711754 X:97244371-97244393 CCTTTTTACTAGTGCCATTACTA 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194711756 Original CRISPR TTACTATTGTGACCTAAACC TGG Intronic
912046215 1:105461703-105461725 TTTCTGTTGTGAACTAAACATGG - Intergenic
912520527 1:110241682-110241704 CTACTATTGTGTCCTCAGCCTGG + Intronic
919187810 1:194176570-194176592 TTACTATTTTGACATAAAGGGGG - Intergenic
1064010165 10:11729332-11729354 TTGCTATTGTAACCTAACCCAGG - Intergenic
1069624168 10:69857180-69857202 TTACGATTCTGACCCCAACCTGG + Intronic
1071172462 10:82882601-82882623 TCACTTTTGAGACCTAAACAAGG - Intronic
1079711897 11:23694366-23694388 TTAGTATTGTGACTAAGACCAGG - Intergenic
1086087979 11:82975323-82975345 TTACTATTGTTATTTAATCCAGG + Exonic
1087184418 11:95172776-95172798 TTAATGTTGTGTCCTAAATCTGG - Exonic
1088526650 11:110763066-110763088 TTCTTATTGTGATCAAAACCTGG - Intergenic
1093566644 12:20614331-20614353 TTAATATTGAGATCTAAACTGGG - Intronic
1094077445 12:26492566-26492588 ATACTATTCAGACTTAAACCAGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098576338 12:72047134-72047156 TTAATATTCTGACCAAAACAGGG + Intronic
1099571669 12:84328141-84328163 TTACTATTGAGCCTTGAACCAGG - Intergenic
1103835330 12:123814949-123814971 TTATTTCTGTGACGTAAACCAGG - Intronic
1107070578 13:36263952-36263974 TTACTATGGTAGCCTAAACTTGG - Intronic
1109115300 13:58374685-58374707 AAACTATTGTGACTTAAAACAGG - Intergenic
1112094252 13:96114995-96115017 TTCCTATGGTTACCTAAACTTGG - Intronic
1121367915 14:93332276-93332298 TTACTATTGCGGGATAAACCTGG - Intronic
1132083059 15:98883990-98884012 TTATTATTGTTACCTAGACTTGG + Intronic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1146636519 17:34510193-34510215 TTACTATGGTGACCTACCACAGG + Intergenic
1159788027 18:72738595-72738617 TTATTATTGTAACCTAAATGTGG + Intergenic
925709959 2:6729246-6729268 TTGCTATTGTGACCTAACTCAGG - Intergenic
928601132 2:32904505-32904527 TTAATATTATTACCTAATCCTGG - Intergenic
935228074 2:101071610-101071632 TTACTACTCTGATCTAGACCTGG - Intronic
940616681 2:156057430-156057452 ATACTACTGTGTCCTAAACATGG - Intergenic
941523331 2:166576172-166576194 TTACTATTCTTACCTAAAAATGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
947601942 2:231457170-231457192 TTACTGTTGTGACCGAAGCTGGG - Intronic
1173956761 20:47039161-47039183 TAACTATTTTGACCTAGACCAGG + Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180195042 21:46189002-46189024 TCACTCTTGTTCCCTAAACCAGG + Exonic
950994854 3:17484382-17484404 TTATGATTGTTACCCAAACCTGG - Intronic
951146418 3:19233200-19233222 CTACTATTGTGTCCTGAAACTGG - Intronic
951344349 3:21528765-21528787 TTACTATTATGCTCTAATCCTGG + Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
957780082 3:84807617-84807639 TTACTACTGTTATATAAACCAGG - Intergenic
958032257 3:88125987-88126009 TTACTATTGTAACCTAAGTAGGG - Intronic
958613802 3:96463514-96463536 ATACTATGCAGACCTAAACCTGG + Intergenic
959739731 3:109703619-109703641 TTACCATTGTAAACTAAACATGG - Intergenic
960781782 3:121327917-121327939 TTACTTTTGTGAGCTAAGACAGG + Intronic
965062584 3:163802990-163803012 TTAGTATTGGGACCTTACCCTGG - Intergenic
975349854 4:73333133-73333155 TTATTAATGTCACCAAAACCAGG + Intergenic
975913898 4:79299758-79299780 TTAGGATTGTGACCTTAACCTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977126192 4:93171564-93171586 TGTCAATTGTGTCCTAAACCAGG + Intronic
979191996 4:117873011-117873033 CTACTATTTTTACCTAATCCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981643737 4:146974608-146974630 TTACTATGGTGACCTATAAATGG - Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990310464 5:54533332-54533354 TTATTAATGTGGTCTAAACCTGG + Intronic
992568392 5:78025547-78025569 TTGCTTTTCTGACATAAACCTGG + Intronic
1005282149 6:24285553-24285575 TTACTACTGTGCCATACACCTGG + Intronic
1013128679 6:107210400-107210422 TTACTACTGGTACCTAAAACAGG + Intronic
1016648915 6:146441621-146441643 TTAGCATTGTGACCTACAGCAGG + Intergenic
1021715593 7:23459247-23459269 TCACTATTGTGACCAAAGACAGG + Intronic
1026464498 7:70642518-70642540 TTCCAATTGTGTCCTCAACCAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036785616 8:11684006-11684028 TTACTTTTGGGGCATAAACCCGG - Intronic
1037288540 8:17326235-17326257 TTACTATTTTGAGCTGAAACAGG + Intronic
1042676184 8:71324876-71324898 TCATTATTGGGACCTAAACCAGG - Intronic
1043955481 8:86354175-86354197 TTTCTTGTGTGACTTAAACCTGG + Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1050912857 9:11095883-11095905 TTCCTACTGTGACATGAACCTGG + Intergenic
1051235711 9:14996510-14996532 TGATTATTGTAACCTAATCCTGG + Intergenic
1051536634 9:18166023-18166045 TGATTCTTGTGACCTATACCAGG - Intergenic
1057281041 9:93711689-93711711 TTAGTATTCTGACCTTAAACTGG + Intergenic
1188069579 X:25702631-25702653 TTACTTATGTGACCTAAAATAGG - Intergenic
1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG + Intronic
1194960502 X:100229719-100229741 TTACTATTCTGCCATAAATCAGG - Intergenic
1195277545 X:103297023-103297045 ATATGATGGTGACCTAAACCTGG - Intergenic
1200850020 Y:7873429-7873451 TAAGTATTGTGACATAACCCTGG - Intergenic
1202056008 Y:20830344-20830366 TTATGATTGTGACATACACCTGG + Intergenic