ID: 1194716474

View in Genome Browser
Species Human (GRCh38)
Location X:97291873-97291895
Sequence CCTGACAACCAGATAGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194716474_1194716477 14 Left 1194716474 X:97291873-97291895 CCTTCAACTATCTGGTTGTCAGG 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1194716477 X:97291910-97291932 TTATCCTTAGTTTACAGATAAGG 0: 1
1: 9
2: 116
3: 826
4: 3216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194716474 Original CRISPR CCTGACAACCAGATAGTTGA AGG (reversed) Intronic
900908873 1:5580115-5580137 CATGACAACCAGAGACCTGAAGG - Intergenic
906931304 1:50172167-50172189 CCTGACATCCTTATGGTTGATGG - Intronic
908109177 1:60877757-60877779 ACTGACAACCAGAAAGCTTAAGG - Intronic
909423989 1:75499980-75500002 ATTGACAGCCAGATAGTGGATGG - Intronic
916089318 1:161294923-161294945 CCTGACTACCAGCAAGTTAATGG - Intergenic
916329731 1:163601196-163601218 CCTGAGAACCAGAGGGCTGATGG - Intergenic
916385666 1:164264975-164264997 CCTGATGACTAGAAAGTTGAGGG - Intergenic
917651819 1:177085285-177085307 CCTGACAACTAAAGAGATGAAGG + Intronic
918743276 1:188164482-188164504 CCTGACTCTCAGAAAGTTGAGGG + Intergenic
920022176 1:202964849-202964871 CCTGACAATAATATAGTTGAGGG + Intronic
922003221 1:221502239-221502261 CCTGAGAACTAGAGAGATGATGG + Intergenic
922175567 1:223194616-223194638 GCTGACAACCAGATTGGTTATGG + Intergenic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
923266324 1:232318027-232318049 CCAGACAACCAAAGAGTAGATGG + Intergenic
923663597 1:235979661-235979683 CCTGACAACCAGAAGGATAAGGG + Intronic
1065312466 10:24429840-24429862 CCTGACAAACAGATTTTTGAGGG - Intronic
1070471324 10:76782979-76783001 GTTGACAATCAGATAGTTGTAGG - Intergenic
1070788087 10:79173935-79173957 CCTGCCAACCAGAAAGATCAGGG + Intronic
1081760539 11:45573838-45573860 CCTGAGAATCAGAGAGGTGAAGG + Intergenic
1090491046 11:127161265-127161287 CCTGCAAACCAGAGAGTTAAGGG - Intergenic
1093780588 12:23132386-23132408 CCTGAGAACCAGTGAGCTGATGG - Intergenic
1095243981 12:39897058-39897080 CCTGAGAACAAACTAGTTGATGG + Intronic
1095328064 12:40922335-40922357 CCTGACAAACAGAAAGATGCTGG + Exonic
1096544858 12:52331030-52331052 CCTGGCCACCAGATAGTTATAGG + Intergenic
1097370349 12:58771199-58771221 CTTGAAAACCAGATAGTCGTAGG - Intronic
1100811602 12:98344341-98344363 CCTTGCAACCAGATCTTTGATGG + Intergenic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1107277411 13:38691954-38691976 ACTGACAACCAGCTTGTGGATGG - Exonic
1107516887 13:41138091-41138113 ACTCACAATCAGAAAGTTGAGGG - Intergenic
1108125161 13:47234557-47234579 ACTGAGAAGCAGATATTTGAGGG + Intergenic
1108262044 13:48668055-48668077 TCTGACAAGCACATATTTGAGGG - Intronic
1112489434 13:99848536-99848558 CCAAACATCCAGATACTTGAAGG - Intronic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1120638831 14:86984883-86984905 GCTGAGGACCAGACAGTTGATGG + Intergenic
1121517537 14:94562708-94562730 CCTGACAACCGGATACTGGTGGG + Intronic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1125392289 15:39206878-39206900 CCTGACAACAAGATTGCTGATGG - Intergenic
1127965864 15:63922532-63922554 CCAGAAAACCAGATTGGTGAGGG + Intronic
1130068654 15:80628173-80628195 CCTGAGAGCCAGAGAGCTGATGG - Intergenic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1131573537 15:93563696-93563718 TCTGGCAACCAGGTAGATGAAGG - Intergenic
1137758456 16:50920904-50920926 CCTGACAGCAAGAGAGCTGAAGG - Intergenic
1137974759 16:53022011-53022033 ACTTACAACCAGATAGATGGTGG + Intergenic
1140422772 16:74834360-74834382 CCTGACATCCTGATTCTTGAAGG - Intergenic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1145320027 17:21760760-21760782 ACTGACATCCAGATAGAAGATGG + Intergenic
1156882176 18:42093816-42093838 CATGCCAACCAGATGTTTGAGGG - Intergenic
1164162649 19:22638507-22638529 GCTAACAACCAGATGGTTGTAGG + Intronic
1164798024 19:31051835-31051857 CCTGAGAACCTGGGAGTTGATGG + Intergenic
925192385 2:1894982-1895004 CCAGACAAACACATCGTTGATGG - Intronic
927844689 2:26465313-26465335 ACTGAAAACCAGAGAGGTGAAGG + Intronic
935637219 2:105258554-105258576 CCTGAGAACCAGGGAGCTGATGG - Intergenic
935738826 2:106128581-106128603 CCTGAGAACCAGAGAGCCGAGGG - Intronic
940343515 2:152605152-152605174 GCTGACAACCAGAGATTTAAGGG - Intronic
945648502 2:212531588-212531610 CCTCATCACCAGTTAGTTGATGG - Intronic
945890061 2:215421142-215421164 CCTAACAAGCAGATATTTAAAGG - Intronic
1174615075 20:51829175-51829197 CCTGACTACCACATAGGTAACGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
951391129 3:22105566-22105588 CCTGAAAGCCAGAGAGCTGATGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954101386 3:48375311-48375333 CTTGGCCACCAGATAGTTAAGGG - Intronic
954390772 3:50267057-50267079 CATGACAGCCAGATAGGGGAGGG - Intergenic
955644276 3:61119804-61119826 CCTGAAAACCAGAGAACTGAAGG - Intronic
956721248 3:72119731-72119753 CCCGAGAACCAGAGAGTTGATGG - Intergenic
961268617 3:125670837-125670859 CCTAACATTCACATAGTTGAAGG - Intergenic
961984989 3:131122627-131122649 CCTGAGAACCTGCTAGATGAAGG + Intronic
966013325 3:175109714-175109736 TCTGACAACCAGTTAGTTGCTGG - Intronic
967648079 3:191951066-191951088 CCTTGCAACCAGATATTTTATGG - Intergenic
968150862 3:196335640-196335662 CCTGTCAGCCAGAGGGTTGATGG - Intronic
970477077 4:16434711-16434733 CCTGAGAACCAGCTGGTTGCAGG + Intergenic
970520090 4:16874548-16874570 CCTCTCAATCAAATAGTTGAGGG + Intronic
971780608 4:31029464-31029486 CATGAAAACCAGATATTTGCAGG + Intronic
971873337 4:32273047-32273069 CCTCACACTCAGCTAGTTGATGG - Intergenic
972842777 4:42951072-42951094 CCTGACATCCAGATAACTGATGG + Intronic
974279405 4:59772966-59772988 CCTGTAAAAGAGATAGTTGAGGG - Intergenic
974725104 4:65788576-65788598 CCTGAGAACCAGGAAGCTGATGG + Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
977183764 4:93910587-93910609 GCTGAAAATCAGATAGTTGTAGG + Intergenic
977962835 4:103104795-103104817 CCTGACAACTAGATTTTTAATGG + Intergenic
982703702 4:158684768-158684790 ACTGAGACCCAGATATTTGAAGG + Intronic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
987243592 5:16026274-16026296 CCTGAGAACAAGAAAGCTGATGG + Intergenic
988200189 5:28057955-28057977 CCTGAGAACCAGGGGGTTGATGG + Intergenic
993892659 5:93491828-93491850 CCTGAGAACCAGGGAGCTGATGG - Intergenic
996926937 5:128838707-128838729 TGTGACAATCAGATATTTGAAGG - Intronic
996992042 5:129646897-129646919 CCTGAAAATCAAATAGATGATGG - Intronic
1000982567 5:167832096-167832118 CCTGACAAACAGTTAGTTATTGG - Intronic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1003232621 6:4268293-4268315 CCTGAGAACCACAGAGCTGATGG - Intergenic
1004401962 6:15297076-15297098 CGTGACAACCAGATGTTTGTAGG + Intronic
1007854989 6:44846413-44846435 CCAGACAACCTTACAGTTGAAGG + Intronic
1008814548 6:55549565-55549587 CCTGATAGCCACAAAGTTGAAGG + Intronic
1011558160 6:88589937-88589959 CCTGAGTACCAGAGAGGTGAAGG + Intergenic
1011806013 6:91073327-91073349 CCTGAGATCCAGAGAGCTGATGG + Intergenic
1013722818 6:113051274-113051296 CCTGACAAAGAGAGGGTTGATGG + Intergenic
1014919908 6:127201929-127201951 CATCATAGCCAGATAGTTGACGG - Intergenic
1016913177 6:149219121-149219143 AGTGACAACCAGATAGTTAAAGG + Intronic
1029612435 7:101634241-101634263 CCTGGCAATGAGAGAGTTGATGG - Intergenic
1030094797 7:105888669-105888691 CATGCCAACCAGATGGTTAAAGG - Intronic
1032393120 7:131569421-131569443 CCTGACAATCAAATAGCTTAGGG + Intergenic
1032480242 7:132240305-132240327 TCAGACAACCAGAAAGCTGAAGG - Intronic
1035815540 8:2535979-2536001 GATGACAGCTAGATAGTTGATGG + Intergenic
1037198301 8:16219210-16219232 CTTGAAGACCAGATAGTTGTAGG + Intronic
1044524697 8:93239450-93239472 CCTGACAACCGTATGGGTGATGG + Intergenic
1047184692 8:122622121-122622143 CCTGAGAGCCAGAGATTTGATGG - Intergenic
1047993297 8:130309348-130309370 CCTGACTAACAGAGAGGTGATGG + Intronic
1048590838 8:135819149-135819171 CATGACAACCATATATTTGTAGG - Intergenic
1052628917 9:31011823-31011845 GTTGACAATCAGATAGTTGTAGG - Intergenic
1052957720 9:34267070-34267092 CAGGAAAATCAGATAGTTGAGGG + Intronic
1056105750 9:83344653-83344675 CCTGAGAACCAGAGAGTCAATGG - Intronic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1060357541 9:122924182-122924204 GCAGCCAACCAGATAGTTCAGGG + Intronic
1061107971 9:128546954-128546976 CCTGACAGCCAGTCAGCTGATGG + Intergenic
1188738788 X:33751420-33751442 GCTGAAGATCAGATAGTTGAAGG + Intergenic
1189197276 X:39162768-39162790 CCAGGCCACCAGATAGTTAAAGG + Intergenic
1191653112 X:63563584-63563606 ACTGATAACCAGATAGTCGAGGG + Intergenic
1192592872 X:72375482-72375504 CCTGAGAACCAGAGGGCTGATGG + Intronic
1193753029 X:85371002-85371024 CCTGATGACCAAATAATTGAAGG + Intronic
1194716474 X:97291873-97291895 CCTGACAACCAGATAGTTGAAGG - Intronic
1197675216 X:129322604-129322626 CTTCACAGCCAGATGGTTGAGGG - Intergenic