ID: 1194717920

View in Genome Browser
Species Human (GRCh38)
Location X:97308479-97308501
Sequence GTGTTAAAAAGCCTCTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194717918_1194717920 7 Left 1194717918 X:97308449-97308471 CCTCACTTCTGTACAGCCTACAA No data
Right 1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG No data
1194717915_1194717920 15 Left 1194717915 X:97308441-97308463 CCCTTTTCCCTCACTTCTGTACA No data
Right 1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG No data
1194717916_1194717920 14 Left 1194717916 X:97308442-97308464 CCTTTTCCCTCACTTCTGTACAG No data
Right 1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG No data
1194717919_1194717920 -9 Left 1194717919 X:97308465-97308487 CCTACAAGTCTTATGTGTTAAAA No data
Right 1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG No data
1194717917_1194717920 8 Left 1194717917 X:97308448-97308470 CCCTCACTTCTGTACAGCCTACA No data
Right 1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194717920 Original CRISPR GTGTTAAAAAGCCTCTGCTA AGG Intronic