ID: 1194723135

View in Genome Browser
Species Human (GRCh38)
Location X:97364079-97364101
Sequence GCAACATGGCTAGCTGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194723133_1194723135 17 Left 1194723133 X:97364039-97364061 CCTTAATTCAGCAGAGCAATTCT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1194723135 X:97364079-97364101 GCAACATGGCTAGCTGATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194723135 Original CRISPR GCAACATGGCTAGCTGATAG AGG Intronic
906322924 1:44827863-44827885 GCAACGGGGCAAACTGATAGCGG + Exonic
909718910 1:78742750-78742772 GCAAAATGTCTAGCAAATAGTGG - Intergenic
910798961 1:91126579-91126601 GGAAGCTGTCTAGCTGATAGTGG + Intergenic
911965261 1:104360604-104360626 GCAGCATGGCTCTCTGATATTGG + Intergenic
915124234 1:153652156-153652178 CCACCATGCCCAGCTGATAGTGG - Intergenic
916558451 1:165912479-165912501 GAAAGGTGGCAAGCTGATAGGGG - Intergenic
917603951 1:176606317-176606339 GCAAAATGTTTAGCTGATAGTGG + Intronic
922586640 1:226738518-226738540 GCAACAGGGCGCGCTGAGAGCGG - Intronic
1064432836 10:15285968-15285990 GCTACATGGCTAGCACATGGTGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069020163 10:63477819-63477841 GCAAAATGCATATCTGATAGAGG + Intergenic
1071333699 10:84585124-84585146 GAAGCATGGGTACCTGATAGTGG - Intergenic
1073614598 10:104980961-104980983 GAAACATGTCTACCTGATACCGG + Intronic
1079110431 11:17602223-17602245 CCAAGCTGGATAGCTGATAGGGG - Exonic
1083597142 11:63923367-63923389 GCAATACTGCTAGCTGAAAGGGG - Intergenic
1086152261 11:83625118-83625140 GGCACAGGGCTAGCTGACAGTGG - Intronic
1091994654 12:4983732-4983754 GCAACATGGCAGCCTGATAGAGG + Intergenic
1099431565 12:82592327-82592349 CCAACATGGGGAGGTGATAGGGG - Intergenic
1108591890 13:51919900-51919922 GCATCATGCCTAGCTCATAGTGG + Intergenic
1110629556 13:77692117-77692139 GCAACAAGCCTTCCTGATAGTGG - Intergenic
1113500220 13:110767471-110767493 GGCACAGGGCTGGCTGATAGAGG + Intergenic
1116961720 14:50973899-50973921 GCAACATGGTGAGCTGAGGGTGG - Intergenic
1119469946 14:74889856-74889878 GCTACAAGGCTACCTGTTAGCGG - Intronic
1121779207 14:96611127-96611149 GCAGCAAGTCTGGCTGATAGCGG - Intergenic
1122275782 14:100590108-100590130 TCAGCATGGCTAGCTGATGCTGG - Intergenic
1126138203 15:45412780-45412802 ACAATATGGCTACCTGATAGTGG + Intronic
1135224176 16:20641248-20641270 GCCATTTGGCTAGCTAATAGAGG + Intronic
1142860646 17:2758931-2758953 GCTACATGGGAAGCTGATGGAGG - Intergenic
1144611030 17:16715812-16715834 GAAACATGGCTATCTGAGTGAGG + Intronic
1144901707 17:18599551-18599573 GAAACATGGCTATCTGAGTGAGG - Intergenic
1144929365 17:18846509-18846531 GAAACATGGCTATCTGAGTGAGG + Intronic
1145130797 17:20346516-20346538 GAAACATGGCTATCTGAGTGAGG + Intergenic
1147359139 17:39920477-39920499 CCAACATGGCTAGGAGAGAGAGG - Intergenic
1152481023 17:80552755-80552777 GTAACATGGCTAGCAGTGAGAGG + Intronic
1154404985 18:14082797-14082819 GCTACTTGAGTAGCTGATAGAGG - Intronic
926680772 2:15662383-15662405 GCAATATGGCTAGATTATAGTGG + Intergenic
927224948 2:20755329-20755351 GCACCATGGCTGGGGGATAGAGG - Intronic
927562287 2:24082700-24082722 GAATCATGGTTAGCAGATAGAGG - Intronic
930366157 2:50442244-50442266 GCACCATGCCTAGCACATAGTGG + Intronic
932218463 2:69982524-69982546 GCCATATGGGTAGCTGAAAGGGG + Intergenic
936505636 2:113103511-113103533 GAATCATTGCTAGCTGCTAGAGG - Intergenic
940585482 2:155643323-155643345 GCAACATTTCAAGCTGATTGTGG + Intergenic
947953059 2:234164551-234164573 GCTACATGACTTGCTCATAGTGG - Intergenic
1176270260 20:64232518-64232540 GCCACATGGGTAGCGGATGGGGG + Intronic
1177811030 21:25925181-25925203 GCAAAATGCCTAGCTGGAAGTGG - Intronic
949926832 3:9048311-9048333 GCTGCATGGCCAGCTGCTAGAGG + Intronic
952465639 3:33582406-33582428 GCAACATGGGTAGGTGAGTGGGG + Intronic
958269791 3:91485655-91485677 CCAACATGCCTAGCTGATTTTGG + Intergenic
958688623 3:97431849-97431871 TCAACATGGCAAACAGATAGCGG + Intronic
963563090 3:146892007-146892029 GCAACATGGCTGTATCATAGAGG + Intergenic
970385221 4:15549430-15549452 GCAAGATGGCTGGCTGATCATGG - Intronic
971919527 4:32918963-32918985 TCAAGATAGCTAGCTGATAATGG - Intergenic
972843563 4:42960019-42960041 CCAACGTGGCTACCCGATAGGGG + Intronic
984298605 4:177886393-177886415 CCAGCAGAGCTAGCTGATAGAGG + Intronic
984820302 4:183876046-183876068 GCAACAATTCTAGCTGATATGGG - Intronic
987124507 5:14798976-14798998 ACAACTTGGCTAACTGATAGAGG - Intronic
988909868 5:35828296-35828318 GCAACATGGCTTGCTTTTTGAGG - Intergenic
995283457 5:110360396-110360418 GCAAAATACCTAGGTGATAGTGG + Intronic
995894683 5:116998273-116998295 GGAACATGCCTGGCTGACAGAGG + Intergenic
997215912 5:132110555-132110577 GCCACAGGGCTAGATGATAAGGG + Intergenic
1005965772 6:30725448-30725470 GAAACACGGCTGGCTGATGGAGG + Intergenic
1009549428 6:65068386-65068408 GCAACAAGGATAGGTGATGGAGG - Intronic
1016678951 6:146805626-146805648 GGAACATGCCTTGCTGTTAGTGG - Intronic
1022395137 7:29981472-29981494 CAAACATGCCTAGCTGACAGGGG + Intronic
1026077450 7:67185322-67185344 GCAGCATGGCTTGGTTATAGAGG + Intronic
1026699419 7:72626829-72626851 GCAGCATGGCTTGGTTATAGAGG - Intronic
1027272949 7:76533947-76533969 GGAACAGGGCTATCTGAGAGCGG + Intergenic
1027326398 7:77053031-77053053 GGAACAGGGCTATCTGAGAGCGG + Intergenic
1056778549 9:89532354-89532376 GCCACATGGATAGCTCAGAGAGG - Intergenic
1059823929 9:118005649-118005671 GCAAAATGGAATGCTGATAGAGG + Intergenic
1188380895 X:29490419-29490441 GCTACATGGGTGGCTGATACAGG + Intronic
1188708204 X:33361320-33361342 GCCACATGCCTACCTGATCGTGG - Intergenic
1192559527 X:72116868-72116890 GAAACTTGGCTAGCTGTTATGGG + Intergenic
1192614435 X:72604247-72604269 GCAACATAGCTAGTAAATAGTGG - Intronic
1194723135 X:97364079-97364101 GCAACATGGCTAGCTGATAGAGG + Intronic