ID: 1194725941

View in Genome Browser
Species Human (GRCh38)
Location X:97397508-97397530
Sequence ACTCAGGCATAGCCCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194725941 Original CRISPR ACTCAGGCATAGCCCTGCTG AGG Intronic
901210254 1:7520517-7520539 ACTCAGCCAGACCCCTCCTGTGG - Intronic
903694034 1:25194537-25194559 GCTCAGACTCAGCCCTGCTGGGG + Intergenic
904359054 1:29960549-29960571 ACTGGGGCCAAGCCCTGCTGTGG + Intergenic
904486281 1:30826346-30826368 AGTGTGGCATAGCCCTGCTTTGG + Intergenic
904669336 1:32151270-32151292 ACTAAGCCATAGCCCTTCTTAGG + Intronic
906323230 1:44829296-44829318 ACACAGGCATAGGCCAGCTGTGG + Exonic
906660520 1:47578343-47578365 TCTCAGGCACTGCCCTGCAGGGG + Intergenic
912132749 1:106622000-106622022 ATTCAAGCATAGCACTGTTGAGG - Intergenic
912530267 1:110315719-110315741 ACTCAGTCACTGCCCTGATGGGG + Intergenic
915230574 1:154442641-154442663 ACTCTGTCTTAGCCCTGCTTTGG + Intronic
919742546 1:200989620-200989642 ACTCAAGCCTAGCACTGCTTTGG + Intronic
920502030 1:206491505-206491527 CCAGAGACATAGCCCTGCTGTGG + Exonic
1063145369 10:3290712-3290734 ACTGAGGCCCATCCCTGCTGTGG - Intergenic
1063259557 10:4370561-4370583 ACTCAGTCATAACTCTGCAGAGG + Intergenic
1064319274 10:14287174-14287196 CATCAGGCATGGACCTGCTGAGG + Intronic
1064359986 10:14655771-14655793 ACTGAGGCTTAACCCTCCTGGGG + Intronic
1069625914 10:69867557-69867579 CCCCAGGCTCAGCCCTGCTGGGG - Intronic
1069783417 10:70971153-70971175 ACTAAGGCATCACCCTCCTGGGG - Intergenic
1070778996 10:79126766-79126788 ACTGAGGCACTTCCCTGCTGTGG - Intronic
1074868207 10:117557193-117557215 ACACAGGCATAGCCCCCCTCCGG + Intergenic
1074869582 10:117566202-117566224 ACTCAGCCAGACCCCTGGTGTGG + Intergenic
1074912560 10:117924746-117924768 ACTGGGGCTCAGCCCTGCTGGGG - Intergenic
1075264549 10:120989474-120989496 ACTCAGGCCTAGCTGAGCTGAGG + Intergenic
1076622200 10:131797796-131797818 AATCTGACTTAGCCCTGCTGTGG - Intergenic
1076794452 10:132791854-132791876 CCTCAGCCTCAGCCCTGCTGCGG + Intergenic
1077121961 11:913304-913326 ACTCATGCATTGGCCTGGTGAGG - Intronic
1077378129 11:2215171-2215193 AGTCAGGCATGGACCTGCAGAGG - Intergenic
1077434537 11:2532479-2532501 ACTCAGTCATGGCCATGGTGGGG + Intronic
1078892901 11:15573348-15573370 ACACAGGCATAGCCAGACTGGGG + Intergenic
1084882351 11:72180720-72180742 ACACAGACACAGCCCTGCTTTGG - Intergenic
1086462891 11:87023063-87023085 AAGCAGGCATGGCCATGCTGGGG - Intergenic
1087650772 11:100864470-100864492 ACTCAGACATAGGCCAGGTGCGG - Intronic
1088811817 11:113397431-113397453 ACTCATGCACAGCCCAGCTTGGG + Intronic
1090106703 11:123861030-123861052 AGTCAGGTATACACCTGCTGTGG - Intergenic
1090660987 11:128881273-128881295 CCTGATTCATAGCCCTGCTGAGG - Intergenic
1091641866 12:2243379-2243401 CCTCAGGCACAGCCCAGCTTTGG - Intronic
1092126046 12:6075610-6075632 ACTGAGACTTAGCCCTGCTAGGG + Intronic
1098913613 12:76235249-76235271 TCTCAGGCTTAGGCCTGATGAGG - Intergenic
1100294454 12:93247885-93247907 ACACAGGCATAGTCATACTGTGG - Intergenic
1100727671 12:97426026-97426048 ACTGACCAATAGCCCTGCTGTGG - Intergenic
1104778888 12:131407119-131407141 AATGAGGCACAGCCCTTCTGAGG - Intergenic
1104943275 12:132404697-132404719 CCTCTGGCCTAGCCCTGCTGGGG - Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1107608487 13:42087198-42087220 ACTGAGGCAAGGCCCTTCTGAGG - Intronic
1111830531 13:93323574-93323596 ACACAGGCATAGTCCTGTTGAGG - Intronic
1113916512 13:113877245-113877267 ACTCAGGCATCGGCCTTGTGTGG + Intergenic
1113937442 13:114001871-114001893 CCTCAGGGCCAGCCCTGCTGTGG + Intronic
1115385309 14:32789622-32789644 ACTCTAGCATAGGGCTGCTGCGG - Intronic
1120277570 14:82396735-82396757 ACTCTGCCTTTGCCCTGCTGTGG - Intergenic
1122216855 14:100210390-100210412 ACTCAGGGAAACCTCTGCTGTGG + Intergenic
1122262097 14:100529516-100529538 ACTGAGGCCAAGCCTTGCTGGGG + Intronic
1124016485 15:25880750-25880772 CCTCAGACATGGCCTTGCTGTGG - Intergenic
1129036872 15:72655344-72655366 ACTCAGCCATTGCACTGATGAGG + Intronic
1129213015 15:74081881-74081903 ACTCAGCCATTGCACTGATGAGG - Intronic
1129397387 15:75259205-75259227 ACTCAGCCATTGCACTGATGAGG + Intronic
1129400996 15:75283482-75283504 ACTCAGCCATTGCACTGATGAGG + Intronic
1129730152 15:77926197-77926219 ACTCAGCCATTGCACTGATGAGG - Intergenic
1130260215 15:82348754-82348776 ACTCGGGCATCGCGCTGATGTGG - Intronic
1130268515 15:82430679-82430701 ACTCGGGCATCGCGCTGATGTGG + Intronic
1130472388 15:84236434-84236456 ACTCGGGCATCGCGCTGATGTGG + Intronic
1130479879 15:84351005-84351027 ACTCGGGCATCGCGCTGATGTGG + Intergenic
1130491891 15:84437124-84437146 ACTCGGGCATCGCGCTGATGTGG - Intergenic
1130503505 15:84516164-84516186 ACTCGGGCATCGCGCTGATGTGG - Intergenic
1130594686 15:85241070-85241092 ACTCGGGCATCGCGCTGATGTGG + Intergenic
1132809888 16:1792430-1792452 ACTCGGGCAGAGCCCTCCTCGGG - Exonic
1132938191 16:2492760-2492782 TCTGAGGCCTAGTCCTGCTGTGG + Intronic
1134132556 16:11659403-11659425 AGTCAGGAATCGCCCTCCTGGGG + Intergenic
1136931260 16:34419833-34419855 ACAGGGGCAGAGCCCTGCTGTGG - Intergenic
1136973313 16:34991986-34992008 ACAGGGGCAGAGCCCTGCTGTGG + Intergenic
1137731679 16:50694434-50694456 ACTCAGCCATGGGGCTGCTGGGG + Intronic
1137734992 16:50717148-50717170 ACTCTGGACTAGCTCTGCTGAGG + Intronic
1138347324 16:56328061-56328083 CCTGAGGCACAGCCCCGCTGTGG + Intronic
1138934983 16:61708388-61708410 GGTCAGACATAGCACTGCTGTGG - Intronic
1141704973 16:85659835-85659857 ACCCAGGCTAAGGCCTGCTGAGG - Intronic
1142235937 16:88922583-88922605 CCTCAAGCATAGCCCTGGCGTGG - Intronic
1142284745 16:89167176-89167198 ACTCAGCCTCAGCCTTGCTGGGG + Intergenic
1142285949 16:89171617-89171639 ACTCAGCCTTAGCCCTGCCCAGG + Intergenic
1144454221 17:15405905-15405927 GCTCAGGCCTAGCCAGGCTGAGG + Intergenic
1146060698 17:29604913-29604935 GCTAAGGCATAACCCTTCTGAGG + Intronic
1146472716 17:33137520-33137542 ACTGGGGCTTAGCCCTGCAGGGG + Intronic
1146922638 17:36723478-36723500 TCTGAGGCACAGCCCAGCTGTGG - Intergenic
1147166671 17:38597023-38597045 ACTCAGGCACAGCCCTCCCTGGG + Intronic
1147722420 17:42547274-42547296 ACACAGGCCTGGGCCTGCTGGGG + Intergenic
1147723604 17:42553445-42553467 ACGCAGGCCTGGGCCTGCTGGGG + Exonic
1147804189 17:43118210-43118232 ACACAGGCATGGTCCTGCTCAGG - Intronic
1147809179 17:43155007-43155029 ACACAGGCATGGTCCTGCTCAGG - Intergenic
1147993615 17:44349876-44349898 ACTAAGCAACAGCCCTGCTGTGG + Intronic
1148726175 17:49792004-49792026 ACTCTGGCTTAGCCTGGCTGAGG - Exonic
1148745772 17:49917214-49917236 ACTCAGTCACTGCCTTGCTGAGG - Intergenic
1150946051 17:69746796-69746818 TCTCAGGGACAGCCCAGCTGGGG - Intergenic
1151509650 17:74550451-74550473 ACTCAGCCACAGTCCTGCTCTGG - Intergenic
1157382001 18:47227009-47227031 ACTTATGCATAGCCCTGATGGGG - Intronic
1165032258 19:33006656-33006678 ACCCAGACACAGCCCTGCTATGG + Intronic
1168113134 19:54206270-54206292 TCCCAGGCAACGCCCTGCTGCGG + Exonic
927476227 2:23416389-23416411 ACTGAGGCATGGACCTGCAGAGG - Intronic
927945445 2:27132555-27132577 AAAGAGGCATAGCCCAGCTGTGG - Intronic
927962534 2:27250010-27250032 CCTCAGGCTTTGCCCTGTTGGGG + Intergenic
929077708 2:38092237-38092259 ACTCATGCAATTCCCTGCTGAGG + Intronic
930081006 2:47448714-47448736 GCCCAGGCAAAGCTCTGCTGAGG + Intronic
932494234 2:72138606-72138628 GCTCAGGCCAAGCCCTGCAGAGG + Intronic
932702064 2:73998891-73998913 ACGTAGGCATAGCCCTGCAGGGG + Intronic
933268368 2:80206317-80206339 TTTCAGGCATAGCCTTGCTGGGG + Intronic
934219372 2:90067795-90067817 ACTCATTCATAGCCCTGTTCAGG + Intergenic
935408825 2:102737352-102737374 ACTCAGGCATAGACCATCTATGG - Intronic
937069439 2:119051839-119051861 ACTCAGCCCCAGCCCTTCTGCGG - Intergenic
938102526 2:128506886-128506908 ACTCAGGCATGGCCCATCTTGGG - Intergenic
938695256 2:133829269-133829291 AAGCAGGCAGAGCCATGCTGTGG + Intergenic
939593545 2:144096859-144096881 ACTCAGTCAGTGCACTGCTGTGG - Intronic
946148600 2:217749151-217749173 CCTCAGGCCAAGCTCTGCTGAGG - Intronic
946400793 2:219467445-219467467 ACTCAGGCATTGGGCTGCCGTGG + Intronic
948240634 2:236430036-236430058 ACTCCAGCAGACCCCTGCTGAGG - Intronic
948403545 2:237701546-237701568 ACTCAGGGACAGCCCGGCTCAGG - Intronic
1170959940 20:21016284-21016306 ACTGAGGCTCAGTCCTGCTGGGG - Intergenic
1171055799 20:21904836-21904858 ACTGAGGCTTAGCCCTCCTGGGG - Intergenic
1173061305 20:39664240-39664262 ACTCAGGCTTAGAGATGCTGAGG + Intergenic
1173913336 20:46687402-46687424 TCCCAGGCATAGTCCTGCAGTGG - Intronic
1173947457 20:46963075-46963097 ACTGGGGCTTAGTCCTGCTGAGG - Intronic
1175615274 20:60393081-60393103 ACCCAGGCAGAAACCTGCTGGGG - Intergenic
1175693336 20:61082281-61082303 TCTCAGGGAGAGGCCTGCTGTGG - Intergenic
1175808493 20:61844897-61844919 GGGCAGGCATGGCCCTGCTGGGG - Intronic
1178110273 21:29363250-29363272 AGTCAGGCATCTCCCTGCTCAGG - Intronic
1178638938 21:34330319-34330341 CCTCAGGAACAGGCCTGCTGCGG + Intergenic
1181971870 22:26697096-26697118 ATTCAGACAGAGCCCTACTGAGG - Intergenic
1182351469 22:29702424-29702446 ACCCTGGCACACCCCTGCTGTGG + Intergenic
1182430248 22:30294940-30294962 GCTCATGCATATGCCTGCTGAGG - Exonic
1184684684 22:46090789-46090811 ACTCACCCATTGCCCTGCTGTGG + Intronic
949193827 3:1282237-1282259 ACTCCAGCATAGGCCTTCTGTGG + Intronic
949411567 3:3771094-3771116 AGTCATGCAGAGCCCTACTGGGG + Intronic
950259644 3:11534889-11534911 ACGTAGGCGCAGCCCTGCTGCGG + Intronic
952763373 3:36934863-36934885 ACTCAGGGATAGCTATTCTGGGG - Intronic
953876069 3:46667581-46667603 GCTCAGGCCTGGCCCTCCTGGGG - Intergenic
958741048 3:98072588-98072610 ACTTAGGCTTAGTCCTCCTGGGG + Intergenic
959666681 3:108930832-108930854 TCTCAGTCATAGCTCTGCTAGGG - Intronic
961376353 3:126468701-126468723 ACTCAGGCAGAGTCCTGCTCTGG - Intronic
961769159 3:129235923-129235945 ATCCAGGCATAGCTCAGCTGGGG - Intergenic
962863508 3:139426422-139426444 ACTCAGTCACAGGCCTGCTGAGG - Intergenic
967048930 3:185764311-185764333 CCTAAAGCATAGCCCTGATGAGG - Intronic
968958031 4:3728867-3728889 AGTCAGGCAGAGCCCAGCAGCGG - Intergenic
969304232 4:6316688-6316710 ACTCAAGGACAGCCCTGCTGTGG - Intergenic
969900863 4:10348034-10348056 ACTGAGGCTCAACCCTGCTGGGG + Intergenic
972985692 4:44761708-44761730 CCTAAGTCATAGCCCTTCTGGGG - Intergenic
976367848 4:84250004-84250026 ACCCAGGCATGGCTCTTCTGGGG - Intergenic
978408642 4:108405652-108405674 GCTTAGGCAAAACCCTGCTGGGG - Intergenic
982482765 4:155932702-155932724 CCTCATGCTTAGTCCTGCTGGGG - Intronic
984928608 4:184827088-184827110 GCCCAGGCATAGCCCTGCGTTGG - Intergenic
985028169 4:185760030-185760052 ACTCAAGGATAGCCCAGCTTAGG + Intronic
985832774 5:2247967-2247989 ACTCAGCCATGGCCCTGATGAGG - Intergenic
986180972 5:5392669-5392691 GTTCAGGCATAGACCAGCTGTGG - Intergenic
987115126 5:14720422-14720444 ACACAGTCATAGCCCTGGTATGG + Intronic
987707155 5:21471858-21471880 GTTCAGGCATAGACCAGCTGTGG + Intergenic
987882050 5:23760794-23760816 ACTCAGGCATAGTCCTGAAAGGG + Intergenic
995580116 5:113590326-113590348 ACTAAGGTATGGCCCTTCTGTGG + Intronic
996394653 5:123001240-123001262 AATGGGGCATAGCCATGCTGTGG + Intronic
1002102542 5:176864566-176864588 ACTCATCCAGAGCCCTGCCGGGG + Intronic
1003032738 6:2616552-2616574 ACTCACTCATTGCCATGCTGAGG - Intergenic
1003711037 6:8590497-8590519 ACTCTGACATAGACTTGCTGCGG + Intergenic
1003982435 6:11402687-11402709 GCTCAGGCATAGGCGGGCTGCGG + Intergenic
1005968545 6:30743727-30743749 ACCGAGGCACAGCCCAGCTGGGG - Exonic
1007183611 6:39948904-39948926 ACCAAGGCACAGCCCTTCTGGGG - Intergenic
1009021070 6:57948639-57948661 GTTCAGGCATAGACCAGCTGTGG - Intergenic
1009900985 6:69807706-69807728 CCTCACGCAGAGCCCTACTGGGG - Intergenic
1010649971 6:78442536-78442558 ATTGAGGCAAAACCCTGCTGTGG - Intergenic
1013545154 6:111149345-111149367 ACAGTGGCATAGCCTTGCTGAGG - Intronic
1018905960 6:168076042-168076064 ACTCAGGAAGAGCTCTGCAGGGG - Intronic
1021622305 7:22560852-22560874 TCTGAGGCACAGCCCTGTTGTGG + Intronic
1023856566 7:44187798-44187820 GCTCAGGGACAGCTCTGCTGTGG + Intronic
1024059512 7:45687357-45687379 ACACAGGTACACCCCTGCTGTGG - Intronic
1026582950 7:71633242-71633264 TCCCAGGCACAGCCCGGCTGTGG + Intronic
1031013630 7:116549199-116549221 GCCCAGGCCCAGCCCTGCTGGGG - Intronic
1032854315 7:135821662-135821684 ACTCAGGGAAGGCCTTGCTGAGG - Intergenic
1034565979 7:151916185-151916207 CCTCAAACATACCCCTGCTGTGG + Intergenic
1035331963 7:158102258-158102280 CCTCTGGCAAAGCCCTTCTGTGG - Intronic
1039768918 8:40662940-40662962 ATTCATGCAGAGGCCTGCTGAGG - Intronic
1046435709 8:114185854-114185876 TGTCAGGCATAGCCTTGCTGAGG - Intergenic
1047198759 8:122745754-122745776 GCTCAGGGAGAGCCCTGCTGGGG - Intergenic
1047721128 8:127640782-127640804 ACTCAGGAATCACCCTCCTGGGG + Intergenic
1051425483 9:16927703-16927725 ACCGAGGGAGAGCCCTGCTGAGG + Intergenic
1055240502 9:74180178-74180200 ACTCACGCACAGCAATGCTGTGG + Intergenic
1056994719 9:91445357-91445379 ACCCAGGAATGGCCCAGCTGTGG + Intergenic
1057888075 9:98846197-98846219 TCTCTGGCATAGTCCTGGTGAGG + Intronic
1060806621 9:126581656-126581678 ATTCATGCTTAGGCCTGCTGGGG - Intergenic
1060899016 9:127241138-127241160 TTTCAGGCAGAGCCCTGCGGAGG - Intronic
1062302962 9:135885915-135885937 ACTCCTCCATGGCCCTGCTGTGG + Intronic
1062341925 9:136097551-136097573 ACTCAGCCCAGGCCCTGCTGGGG - Intergenic
1062383045 9:136296778-136296800 ATCCAGGCATCTCCCTGCTGAGG - Intronic
1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG + Intergenic
1185883482 X:3760940-3760962 ACACAGGCAAAGCCCTGCCTAGG - Intergenic
1186094793 X:6088402-6088424 ACACAGGCATGGCACTGCTCTGG + Intronic
1188007879 X:25029432-25029454 ACTCGGGCATATCCCTCCTCGGG - Intergenic
1189461049 X:41243359-41243381 TGTCAGGCATATCCTTGCTGGGG + Intergenic
1189736832 X:44080100-44080122 ACTGAGGCTTAGTCCTGCTAGGG + Intergenic
1193614087 X:83667009-83667031 AAGCAGGCATGGCCATGCTGTGG + Intergenic
1194725941 X:97397508-97397530 ACTCAGGCATAGCCCTGCTGAGG + Intronic
1200782015 Y:7225262-7225284 ACACAGGCAAAGCCCTGCCTAGG + Intergenic
1201503287 Y:14669800-14669822 ACACAGGCATGGCACTGCTCTGG - Intronic