ID: 1194727981

View in Genome Browser
Species Human (GRCh38)
Location X:97420759-97420781
Sequence TAGAATCCACAGGATGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194727981 Original CRISPR TAGAATCCACAGGATGAGCT AGG (reversed) Intronic
900872985 1:5318173-5318195 TAGATTCCAAAGGATGATCTGGG - Intergenic
902114399 1:14108991-14109013 CAGAATGCACAGGCTGAGCTAGG + Intergenic
903816867 1:26070352-26070374 TAGAGTCTACATGAGGAGCTTGG - Intergenic
904963734 1:34355583-34355605 TAGAAAACTCAGGAGGAGCTGGG - Intergenic
905171494 1:36112486-36112508 CAGAGTCCACAGGATAAGGTTGG - Intronic
907172350 1:52480139-52480161 TAAAATCCACAGGATTAGATGGG + Intronic
908511049 1:64850267-64850289 CAGAATCTACAGGCTGAGCGGGG - Intronic
908630010 1:66093325-66093347 TAAAAACCACATGATGAGGTGGG + Intronic
908749667 1:67408618-67408640 TAAATTCCATAGGTTGAGCTGGG - Intronic
911300102 1:96162181-96162203 TAGAGTCCACAGGATTTCCTTGG + Intergenic
912106842 1:106288837-106288859 TAAAATGCACATGATGGGCTGGG - Intergenic
915039716 1:152958554-152958576 TCTAAGCCACAGGATGAGCTAGG + Intergenic
918420447 1:184359483-184359505 CAGAATCCAGAGGATGTTCTGGG - Intergenic
919309801 1:195893421-195893443 TGGAATGCACAGGAACAGCTAGG + Intergenic
920562426 1:206948267-206948289 CAGAACCCTCAGGATGAGCAGGG - Intergenic
921711867 1:218380918-218380940 TAGAATTGAAAGGATGAGATAGG - Intronic
922915316 1:229252685-229252707 CAGAATCCACTGGATTTGCTGGG - Intergenic
923673716 1:236063593-236063615 TAAAATCCACAAGATGACCAAGG - Intronic
924275480 1:242381904-242381926 TAGAATCCAGAAGAACAGCTAGG + Intronic
924448676 1:244158140-244158162 TCTAAGCCACAGGATGAGATAGG - Intergenic
1064141896 10:12797732-12797754 TAGCATCCCCAGGATGGACTCGG - Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1067236717 10:44457269-44457291 TAGAATCCACAGTATCTGCCAGG - Intergenic
1068977163 10:63022471-63022493 TATAAGTCACAGGATGAGATAGG + Intergenic
1074885970 10:117693910-117693932 CAGAATTCCCAGGATGAGGTGGG - Intergenic
1076081019 10:127580635-127580657 GAGAATCCACAGGGAGAGCCAGG - Intergenic
1078510975 11:11983747-11983769 GAGATGCCCCAGGATGAGCTGGG + Intronic
1081327922 11:41769031-41769053 TAGAATCCACAGACTGGGCCAGG + Intergenic
1082222091 11:49651328-49651350 TATAATCCAATGGATGACCTTGG + Intergenic
1084230126 11:67746168-67746190 TATGACCCACGGGATGAGCTGGG - Intergenic
1085992064 11:81860768-81860790 TAGAATGCACAGGATTAGCTTGG + Intergenic
1086471559 11:87118735-87118757 TAGAAGCTACAGGAAGGGCTGGG - Intronic
1087663474 11:101014847-101014869 TCTAAGCCACAGGATGAGGTAGG + Intergenic
1088486620 11:110346973-110346995 TCGAAGTCACAGGATGAGATAGG - Intergenic
1089403009 11:118175684-118175706 TGGAACCCACAGGCTGAGCGAGG - Intronic
1092077460 12:5685480-5685502 GAGAAGCCACAGGAAGAGCCTGG + Intronic
1095976737 12:47945336-47945358 TAGAATCCACAGGAAACTCTGGG - Intergenic
1098756941 12:74375986-74376008 TACAATGCAGAGGAAGAGCTAGG - Intergenic
1099852628 12:88121724-88121746 TAGAAACCACATGTTGAGATAGG + Intronic
1100731194 12:97471579-97471601 TAAAATGCAGAGGATGAGCTGGG + Intergenic
1104083331 12:125452148-125452170 TGGAATCCAGGGGATGAGATAGG - Intronic
1104117065 12:125759943-125759965 CAGAAACCACTGGATGAGTTTGG + Intergenic
1104354618 12:128074404-128074426 CAAAATCCACATGTTGAGCTGGG + Intergenic
1107723561 13:43275040-43275062 TAGAAACCACGGGTTGAGGTAGG - Intronic
1109930924 13:69215888-69215910 TATAATCCACAGGAAGAAATAGG + Intergenic
1111906341 13:94260247-94260269 CTGAATCCTCAGGCTGAGCTAGG - Intronic
1113028961 13:105972972-105972994 TAGAATCTACAGGGAGAGCTAGG + Intergenic
1113287446 13:108867471-108867493 TAGATTGCACAGGGTGAGGTTGG - Intronic
1115805983 14:37051982-37052004 TCAATTCCACAGGATGTGCTCGG - Intronic
1117613302 14:57506200-57506222 TAGAATCCATAATATGTGCTGGG + Intergenic
1117809818 14:59534417-59534439 TAGAACTCACAGGATGAGCGAGG - Intronic
1117969286 14:61236337-61236359 TCTAAGTCACAGGATGAGCTAGG + Intronic
1119919960 14:78437637-78437659 CGGAAACCACAGGATGGGCTGGG - Intronic
1120361263 14:83505576-83505598 TCTAAGTCACAGGATGAGCTAGG - Intergenic
1121316415 14:92963633-92963655 TAGAATCCACTGGGTGGGCCTGG - Intronic
1122762112 14:104036859-104036881 TTGAATCCACAGGCTTAACTAGG + Intronic
1124818160 15:33017767-33017789 TAAAATCCATATGATGGGCTGGG + Intronic
1125975706 15:43949565-43949587 TAGCAACTACAGGATGAGATGGG + Intronic
1127249180 15:57212108-57212130 TAGAATCCACAGAATTTGTTAGG - Intronic
1127949808 15:63793894-63793916 TCTAAGCCACAGGATGAGATAGG + Intronic
1128437547 15:67669466-67669488 TAGACACCACAGGATGTGCCCGG + Intronic
1129512685 15:76136671-76136693 CAGATTCTACAGGATGAGATAGG + Intronic
1132890608 16:2202591-2202613 TGGAAGCCACAGGATGGGCCAGG + Intergenic
1134594844 16:15488009-15488031 TCTAAGTCACAGGATGAGCTAGG - Intronic
1134626701 16:15727494-15727516 TAGAATCCAAAATATCAGCTGGG - Intronic
1137402378 16:48164032-48164054 TCTAAGCCACAGGATGAGATAGG - Intergenic
1138305468 16:55970561-55970583 TAAAAGACACAGGCTGAGCTGGG + Intergenic
1144846606 17:18223301-18223323 TCTAAGTCACAGGATGAGCTAGG - Intergenic
1147202556 17:38812963-38812985 TAAAATCTACATGATTAGCTGGG + Intronic
1147805879 17:43131143-43131165 TAGAAGTCAAAGGATGAGTTGGG - Intergenic
1148025076 17:44581585-44581607 TGGAAAGGACAGGATGAGCTGGG - Intergenic
1148832135 17:50440553-50440575 TAGAGACCACAGGCAGAGCTGGG - Intronic
1149213170 17:54326617-54326639 TCTAAGTCACAGGATGAGCTAGG - Intergenic
1152090552 17:78244430-78244452 GAGAAACCACAGCATGGGCTGGG - Intergenic
1153145746 18:2029540-2029562 TAGAATCCACATGCAGAGGTGGG - Intergenic
1153737394 18:8085432-8085454 TAGAATATACAGGATGAGTTCGG - Intronic
1154138103 18:11798488-11798510 AAGAATTCAGAGAATGAGCTGGG - Intronic
1158073337 18:53499341-53499363 TAGAATGCTCAGGCTGAGATGGG - Exonic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1160257187 18:77257708-77257730 TAGAATCCCCTGGATCGGCTTGG - Intronic
1161150285 19:2703980-2704002 TGGAGTCCAGAGGATGAGCAGGG - Intergenic
1161798427 19:6401355-6401377 TAGAACCCAGATGAGGAGCTAGG + Intergenic
1161798706 19:6403180-6403202 TAGAAGCCACTGGTGGAGCTGGG - Intergenic
1163605980 19:18275558-18275580 AAACATCCAAAGGATGAGCTGGG - Intergenic
1164401655 19:27906114-27906136 TAGAAGCCAGGGGATGACCTTGG + Intergenic
1164870954 19:31642252-31642274 TACAATCCTCTGGATGAACTGGG - Intergenic
1166537371 19:43582937-43582959 TAGAATCCACATGTGGTGCTAGG - Intronic
926009667 2:9398212-9398234 TAGAATCCACAAAACCAGCTGGG + Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926819301 2:16835075-16835097 TAGAATCCCCAGGATAAGCCAGG - Intergenic
927333827 2:21897333-21897355 TATAATCCATAGGCTGGGCTGGG + Intergenic
927940285 2:27099313-27099335 TAGAAGGTACAGGATGAGCCTGG + Intronic
929621635 2:43360541-43360563 TAGTTTCCTCAAGATGAGCTTGG - Intronic
933043732 2:77506351-77506373 TAGTATACACAGGATGAGAAAGG + Intronic
935115018 2:100127893-100127915 TCTAATTCACAGGATGAGATGGG + Intronic
935471821 2:103469923-103469945 TCTAAGCCACAGGATGAGATAGG - Intergenic
935743048 2:106167832-106167854 TATAAGTCACAGGATGAGATAGG + Intronic
937314557 2:120922750-120922772 TGGAATCCCCAGGAGGAGCCTGG - Intronic
939186319 2:138865127-138865149 TATTATCCACAGGATGAAGTGGG - Intergenic
940134261 2:150418113-150418135 TCTAAGCCACAGGATGAGATAGG - Intergenic
941015884 2:160355714-160355736 ATGAATCTTCAGGATGAGCTAGG - Intronic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
944238786 2:197465609-197465631 TAAAACCTACAGGATAAGCTAGG + Intronic
945485199 2:210387427-210387449 TAGAATCCTGAGGATGCTCTAGG + Intergenic
945956766 2:216093532-216093554 TAGGATCCACAGGATGAAATGGG - Intronic
946276097 2:218633019-218633041 CAGAAAGCACAGGATAAGCTAGG - Intronic
947588165 2:231369887-231369909 TAGAAACCACAGGAGGGGCCGGG - Intronic
947842988 2:233220568-233220590 CACATTCCACAGGATGTGCTGGG - Intronic
948180871 2:235978957-235978979 TAGAACCTACAGGATTAGATGGG + Intronic
948371382 2:237491625-237491647 TAAAAACCACAGGATGATCAGGG + Intronic
1169965853 20:11216631-11216653 TGGAATCCACAGACTGACCTGGG - Intergenic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1175289938 20:57868850-57868872 TGGATTCCACAGGGTGAGGTTGG - Intergenic
1175989222 20:62779200-62779222 TAGAACCCTGAGGGTGAGCTGGG - Intergenic
1179809290 21:43860058-43860080 TCTAAGTCACAGGATGAGCTAGG - Intergenic
1179843535 21:44093595-44093617 TAGAATACAAAAAATGAGCTGGG + Intronic
1183051843 22:35269079-35269101 TAGAATTCATAGAAGGAGCTGGG + Intronic
1183113255 22:35668799-35668821 TCTAAGCCACAGGATGAGATAGG + Intergenic
1183365102 22:37402803-37402825 CAGAAGCCAGAGCATGAGCTGGG + Intronic
949706529 3:6824447-6824469 CAGAATCCCAAAGATGAGCTGGG + Intronic
951453654 3:22867049-22867071 CAGAATCCACAGTATTAGCCAGG + Intergenic
952652126 3:35739271-35739293 GGGAATTCACAGGATCAGCTTGG - Intronic
954780814 3:53058535-53058557 TAAACTCCATAGGTTGAGCTGGG - Intronic
955247484 3:57240263-57240285 TAGAAAACACAGAATGACCTTGG - Intronic
956878592 3:73488485-73488507 TAGCATCCAAGGGAAGAGCTGGG - Intronic
957794072 3:84980280-84980302 TAAAATCCACAGGCTTAGCAAGG - Intronic
958538218 3:95432191-95432213 TGGAAACCTCAGGATGATCTGGG + Intergenic
961081243 3:124030625-124030647 AAGAATTCAAAGGATGGGCTGGG - Intergenic
962093025 3:132265195-132265217 GAGAGTCCAAAGGAAGAGCTGGG + Intronic
963666335 3:148192455-148192477 AGGAAGCCACAGTATGAGCTGGG + Intergenic
964303106 3:155310757-155310779 TCGAGTCCACAGGTTGAGATGGG + Intergenic
965554469 3:170005174-170005196 CAGCATCCACTGGTTGAGCTTGG + Intergenic
967731565 3:192911864-192911886 TAGAGTGCACAGGATCATCTCGG - Intronic
968598968 4:1500272-1500294 TAGGATCTAAGGGATGAGCTGGG + Intergenic
968963412 4:3757328-3757350 TAGAATCCAGAGAATGTTCTGGG - Intergenic
968990987 4:3912312-3912334 TATGACCCACGGGATGAGCTGGG - Intergenic
969527664 4:7712154-7712176 CAGAGCCCACAGGATGAGCAAGG - Intronic
970054052 4:11951014-11951036 TCTAATTCACAGGATGAGATAGG + Intergenic
970142302 4:12995939-12995961 TAGTATCCTCAGAAAGAGCTAGG - Intergenic
971409045 4:26351168-26351190 TGAAATCCACAGGATGGGCCTGG - Intronic
971452356 4:26811939-26811961 TCGAAGTCACAGGATGAGTTAGG - Intergenic
971703817 4:30013648-30013670 AAGAAGCTACAGCATGAGCTGGG - Intergenic
972234159 4:37110814-37110836 TGAATTCCACAGGATGAGCCAGG - Intergenic
972534921 4:39991818-39991840 TAGAAAGCACAGGATAGGCTGGG + Intergenic
973769645 4:54194752-54194774 GAGAATGCACACGATGAGCCTGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974904016 4:68034389-68034411 TAGGATCTACAGGGTCAGCTAGG - Intergenic
975415071 4:74096599-74096621 TCGAAGTCACAGGATGAGATAGG - Intergenic
980553796 4:134375600-134375622 TTGAATCCACAGGGTGAGATGGG - Intergenic
981691337 4:147512949-147512971 GAGAATCCAGAGGAAGGGCTTGG - Intronic
982024531 4:151238142-151238164 TAAAACCCACATGATGAACTAGG - Intronic
982723984 4:158886075-158886097 TTGAATCAACAGGATCAGCCTGG - Intronic
985677877 5:1241674-1241696 TAGGATTTACAGGATGAGCCGGG + Intronic
986254896 5:6094145-6094167 TCTAATTCACAGGATGAGATAGG + Intergenic
986295592 5:6435451-6435473 GGGACCCCACAGGATGAGCTGGG - Intergenic
990640601 5:57779621-57779643 TAAAATGCTCAGGAAGAGCTAGG + Intergenic
990998454 5:61757501-61757523 TAGAACCCCCAGGGTGAGCTGGG + Intergenic
991363493 5:65844635-65844657 TCTAAGCCACAGGATGAGATAGG - Intronic
993628829 5:90259023-90259045 TAGAACCCAAAGAATGAGCAGGG - Intergenic
996998464 5:129727935-129727957 TATAAGTCACAGGATGAGATGGG + Intronic
998555152 5:143115995-143116017 TAGAATCGACAGGATAAGATGGG + Intronic
999519731 5:152338809-152338831 AAGAATACACAGGATGTTCTAGG - Intergenic
999828593 5:155297944-155297966 TAGAATCCACAGCCTGGACTCGG - Intergenic
1000084539 5:157877896-157877918 TAGACTCCAGAGGCTGAGGTAGG - Intergenic
1001699280 5:173695233-173695255 TTAGATCCAAAGGATGAGCTTGG - Intergenic
1001882476 5:175256514-175256536 AAAAATCCACAAGATGTGCTAGG - Intergenic
1006308401 6:33239386-33239408 TAAAATCCACAGGATGGGCCGGG - Intergenic
1006854494 6:37123714-37123736 TAGAATCCCAAGGCTGAGCACGG + Intergenic
1008482905 6:52005439-52005461 TAGAACCCACAGGAATAGCAAGG - Intronic
1010071507 6:71750648-71750670 TAGAATCTATGGGATCAGCTAGG + Intergenic
1010245351 6:73657121-73657143 GAGAATACACAAGATGAGCCTGG - Intergenic
1010810143 6:80291074-80291096 TCCAATTCACAGGATGAGATAGG - Intronic
1011894502 6:92207612-92207634 TAGAATCCTAAGCATGAGATTGG - Intergenic
1014874391 6:126639246-126639268 GAGAATACAAAAGATGAGCTTGG - Intergenic
1015159108 6:130131917-130131939 TCTAAGTCACAGGATGAGCTAGG - Intronic
1016406880 6:143740344-143740366 TCCAAATCACAGGATGAGCTAGG - Intronic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1018709042 6:166484671-166484693 CAGAAGCCACAGGAAGATCTGGG + Intronic
1020313815 7:6890192-6890214 TATGACCCACGGGATGAGCTGGG - Intergenic
1023784771 7:43695001-43695023 TAGAATCAACAAAATAAGCTGGG - Intronic
1026832275 7:73617547-73617569 TCAAATCCACAGGATGGGCTGGG + Intronic
1028263163 7:88687923-88687945 GAGAATCAATAGGATTAGCTGGG - Intergenic
1030120602 7:106106904-106106926 TAGAATCCTCAGAATTAGCATGG - Intronic
1032558992 7:132868738-132868760 TAGAATCCAAATGAAAAGCTTGG + Intronic
1032866660 7:135932354-135932376 CAGAATCAACAGGAAAAGCTGGG - Intronic
1033108523 7:138554076-138554098 TGGATTCCACAGGCTGAGCTGGG + Intronic
1035283387 7:157791666-157791688 TAAAATCCAGAGGATGCTCTTGG - Intronic
1036683176 8:10891042-10891064 TGGAAGCCACAGGATGAACAGGG - Intergenic
1041680016 8:60579336-60579358 AAAAATCCACAGGATTAGCTGGG - Intronic
1042849935 8:73206659-73206681 TAGAAACCATAGAATGAGCGTGG - Intergenic
1042870417 8:73392883-73392905 TAGCATCCATAGCTTGAGCTAGG - Intergenic
1045006571 8:97921397-97921419 TAGAATGCAGTTGATGAGCTAGG - Intronic
1045255705 8:100519123-100519145 TAGAATTCATATGTTGAGCTTGG - Intronic
1047610674 8:126517797-126517819 TATAATCCACAGGTTAATCTTGG + Intergenic
1048091357 8:131243936-131243958 CAGAATCCACAGCAGGAGCTTGG + Intergenic
1048871605 8:138803839-138803861 TAGAATATAAAAGATGAGCTGGG - Intronic
1051348882 9:16179697-16179719 CAGAATCCGCAGGCTCAGCTGGG + Intergenic
1052487109 9:29116066-29116088 TAGAAATCAGAGGATAAGCTGGG + Intergenic
1052521539 9:29554146-29554168 TCTAAGCCACAGGATGAGATAGG + Intergenic
1052773423 9:32710138-32710160 TGTAAGCCACAGGATGAGATAGG + Intergenic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1055451756 9:76437264-76437286 TCTAAGTCACAGGATGAGCTGGG + Intronic
1055701133 9:78947120-78947142 TCTAACTCACAGGATGAGCTAGG - Intergenic
1056887564 9:90457851-90457873 TGGAATCCAAAGGATGAGCCTGG - Intergenic
1057614403 9:96575983-96576005 CAGAATTCACAGGCTGGGCTTGG + Intronic
1058587978 9:106530907-106530929 TAAAATCCACAGGGTCGGCTGGG - Intergenic
1059253439 9:112907651-112907673 TAGAGTCCACAGGATGGGCAAGG + Intergenic
1059362505 9:113756170-113756192 TAGCATTCTCAGGATGATCTTGG + Intergenic
1185841789 X:3398782-3398804 TAGAAGTCACAGGATGAGACAGG + Intergenic
1187562354 X:20414743-20414765 CAGAATCCACAGGATGAGCATGG - Intergenic
1189000671 X:36941011-36941033 TAGAATACAGAGGATCAGCCCGG + Intergenic
1190003341 X:46710576-46710598 TAGATTCCACAGAATGGACTGGG - Intronic
1193460755 X:81788715-81788737 TAAAATCTACATGATGGGCTGGG - Intergenic
1194727981 X:97420759-97420781 TAGAATCCACAGGATGAGCTAGG - Intronic
1195405014 X:104503181-104503203 TAGAGACCACAGGATAAGGTTGG + Intergenic
1198862744 X:141088444-141088466 TCTAAGTCACAGGATGAGCTAGG - Intergenic
1198899949 X:141498942-141498964 TCTAAGTCACAGGATGAGCTAGG + Intergenic
1200622016 Y:5461917-5461939 TAGATTCCACAGAAATAGCTGGG + Intronic
1202060495 Y:20882451-20882473 TAAAAGCCACAGGGTGGGCTAGG - Intergenic