ID: 1194728666

View in Genome Browser
Species Human (GRCh38)
Location X:97428656-97428678
Sequence GAGGGTTAAGAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1162
Summary {0: 1, 1: 0, 2: 3, 3: 99, 4: 1059}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194728666_1194728673 30 Left 1194728666 X:97428656-97428678 CCCTCCTTCTTCTCTTAACCCTC 0: 1
1: 0
2: 3
3: 99
4: 1059
Right 1194728673 X:97428709-97428731 CACACATTTAGCTACCCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194728666 Original CRISPR GAGGGTTAAGAGAAGAAGGA GGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900732602 1:4272080-4272102 GAGGGAGAAGAAGAGAAGGAAGG - Intergenic
900993361 1:6107905-6107927 GAGGGATAATGGAAGATGGAAGG + Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901667526 1:10835163-10835185 GAGGGGAAAGAGGGGAAGGAGGG + Intergenic
902114140 1:14107062-14107084 GAGGGGAGAGAGATGAAGGAAGG - Intergenic
902119684 1:14152360-14152382 GGAGGTAAAGAGTAGAAGGATGG - Intergenic
902689467 1:18101228-18101250 GAGGGGAGGGAGAAGAAGGAGGG - Intergenic
902833117 1:19030230-19030252 GAGGGAGGAGAGAAGAAGCAAGG + Intergenic
902913017 1:19615053-19615075 GTGGGTCCAGAGAAGGAGGATGG - Intronic
903004779 1:20291536-20291558 GAAGGTTGAGAGAGGGAGGAAGG - Intronic
903447942 1:23434380-23434402 GAGGGTTCAGGGAGAAAGGAAGG + Intronic
903692379 1:25183689-25183711 AAGGGTGGAGAGATGAAGGACGG - Intergenic
904010055 1:27384081-27384103 GAGGGTTAGGAGAAGCAGATGGG - Intergenic
904205678 1:28853635-28853657 GAGGAATAAGAGAGCAAGGATGG + Intronic
904455472 1:30645425-30645447 GAGGGAGAAGAAAAGAAGGGAGG - Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905222678 1:36459701-36459723 GAGGGAGAAGAAAAGAATGAAGG + Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905884928 1:41486606-41486628 GACCGTGAAGAGAAGAAAGAAGG + Intergenic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906286641 1:44592100-44592122 AAGGAATGAGAGAAGAAGGAAGG + Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906650615 1:47509925-47509947 GACGGTAAAGAGAAGTAGCAAGG + Intergenic
906784202 1:48600008-48600030 GAGTGGTCAGAGAAGAAAGAAGG + Intronic
906967500 1:50472888-50472910 GAGAATTCAGAGAAGAATGAAGG + Intronic
907533447 1:55125945-55125967 GAGAGTCAAGAGCAGAAGCAGGG - Intronic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908041320 1:60116704-60116726 GAGGGCTCAGAGAAGGAGGTGGG + Intergenic
908376636 1:63548829-63548851 GAGGGTTTTGAGTAGAAGGCAGG + Intronic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908689874 1:66766985-66767007 GAGGGTTGAGGGTGGAAGGAGGG + Intronic
909181057 1:72424619-72424641 GAGGGTAGAAGGAAGAAGGAGGG + Intergenic
909399595 1:75212334-75212356 GAGGGTGGAGGGTAGAAGGAGGG - Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909887208 1:80957042-80957064 GAGGGTTGAGAGCAGAACAAAGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911374557 1:97036064-97036086 GAGGGGTAAGAGGAAAAGCATGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911596520 1:99804303-99804325 GAGGGTTAAGATTAGAGGCAGGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912667395 1:111594519-111594541 AAGGGGAAAGGGAAGAAGGAAGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913164844 1:116175530-116175552 GGGGGTCAAGGGAAGAAGCAGGG + Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
915635778 1:157185565-157185587 GATGGTTAAGGGCAGAAGCAAGG - Intergenic
915775359 1:158478721-158478743 GATGGGTAAGGAAAGAAGGAAGG + Intergenic
915795377 1:158726736-158726758 AACAGTTAAGAGAAGCAGGAAGG - Intergenic
915977122 1:160398901-160398923 AAGGGTTAAGGGAAGTAGGGAGG - Intergenic
916332101 1:163628394-163628416 GAGGGGTGGGAGGAGAAGGAGGG - Intergenic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
917315930 1:173725724-173725746 GAGGCTTTAGAGAAGCATGATGG - Intronic
917681359 1:177371411-177371433 GAGGGTGAAGGGTGGAAGGAAGG + Intergenic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
917930880 1:179821717-179821739 GAGGATTCAGAGCAGAAGGAAGG - Intergenic
917962045 1:180153382-180153404 GGGTGCCAAGAGAAGAAGGAAGG + Intergenic
918117443 1:181509115-181509137 GAGGATTAAGAGAAGGACTAGGG + Intronic
918389632 1:184045202-184045224 GATGGGGAGGAGAAGAAGGAAGG + Intergenic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
918586357 1:186193255-186193277 GAGGGAGAAGGGAAGGAGGAAGG + Intergenic
919015222 1:192024894-192024916 GAGGGTGGAGAGAGGAAGGAGGG - Intergenic
919227497 1:194725682-194725704 GAGGGTGGAGGGCAGAAGGAGGG - Intergenic
919327431 1:196126432-196126454 GAGGGTAGAGAGTGGAAGGAGGG - Intergenic
919412647 1:197265392-197265414 GAAAGATAAGAAAAGAAGGAAGG - Intergenic
919549732 1:198969784-198969806 GAGGGTGAAGAGTGGCAGGAGGG + Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
920063130 1:203242216-203242238 GAGGTTGCAGAGAAAAAGGAGGG - Intronic
920070089 1:203296519-203296541 AAGGGTGAAGGCAAGAAGGATGG - Intergenic
920103986 1:203537476-203537498 GAGGGATATGAGAAGCAAGAAGG + Intergenic
920179883 1:204126087-204126109 GAGGGCGAAGAGAAGAGCGATGG + Exonic
920690259 1:208141246-208141268 GAGGGATGAGCGAAGAAGTAAGG - Intronic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921256832 1:213349290-213349312 GAGGGTTAGGAAAACAAGAAGGG - Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922710777 1:227829265-227829287 GAGGATGAAGAGAAAAGGGAAGG - Intronic
922723195 1:227909566-227909588 GAGGGAGAAGGGAAGAAGGAAGG + Intergenic
922727193 1:227927965-227927987 GAGGGTGAAGGGAAGAGGGCAGG + Intronic
923148788 1:231216122-231216144 GAGGGAGAAGAAATGAAGGATGG - Exonic
923300709 1:232637989-232638011 GAGGTGTCAGAGAGGAAGGAGGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924539879 1:244970695-244970717 GAGGGGAGAGAGAAGAGGGAGGG - Exonic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1063136693 10:3223316-3223338 GAGGATGAAGAGATGAAGGGTGG - Intergenic
1063140034 10:3247849-3247871 GAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1063956855 10:11275183-11275205 GAGGGCAAAGACAAGAAGCAGGG + Intronic
1064460330 10:15528990-15529012 GAAGGGGAAGGGAAGAAGGAAGG - Intronic
1064708000 10:18092905-18092927 GAGGGTCTAGAGTAGAAGGAAGG + Intergenic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065127894 10:22591790-22591812 GTGGGGTAAGAGGGGAAGGAAGG + Intronic
1065487700 10:26250494-26250516 GTGGGATGAGGGAAGAAGGAGGG + Intronic
1065761577 10:28987787-28987809 GAAGGGGAAGAGGAGAAGGAAGG - Intergenic
1065801169 10:29353992-29354014 GAAGGTTGAGAGAGCAAGGAAGG - Intergenic
1065834590 10:29645265-29645287 GAGGGGGAAAAAAAGAAGGAAGG + Intronic
1066156386 10:32682625-32682647 GAGGTTGTAGAGAAAAAGGAAGG - Intronic
1066279229 10:33898844-33898866 GAGGGGTAAGAAAATAATGAGGG - Intergenic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066985223 10:42459641-42459663 GAGGGAGTAAAGAAGAAGGAAGG + Intergenic
1067481019 10:46597753-46597775 GAGGGGGAAGGGAGGAAGGAAGG - Intergenic
1067613732 10:47744069-47744091 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1067853479 10:49769881-49769903 GAGGAAAAAGAGAGGAAGGAGGG + Intergenic
1068022340 10:51601001-51601023 GAGGGGGAAAAGAAGAAGGGAGG + Intronic
1068337703 10:55659047-55659069 GAGGGTCAGGGGAAGAAAGAAGG - Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1069282294 10:66669915-66669937 GAGGGTGAGGAGAGGAAGGGGGG + Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069461993 10:68604373-68604395 GAGGGTTAAGGAAAGAACTAAGG + Intronic
1070511652 10:77166666-77166688 GAGGAAGAAGAAAAGAAGGAGGG + Intronic
1070549919 10:77482957-77482979 GAGAGAGAAGAGAGGAAGGATGG - Intronic
1070767072 10:79062916-79062938 GGGGGTTAAGACAAGGAAGACGG + Intergenic
1071063270 10:81599533-81599555 GAGGGTGGAGGGTAGAAGGAAGG + Intergenic
1071210288 10:83333990-83334012 GAGCGATAAGAAAAGAAGGATGG - Intergenic
1071333934 10:84586555-84586577 CAAGGATAAGAGGAGAAGGAGGG - Intergenic
1071452925 10:85816848-85816870 GAGGGTGAAGAGTGGAAGGAGGG - Intronic
1071629143 10:87204041-87204063 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071955312 10:90751312-90751334 GAGGGAAAAGGGAAGAGGGAGGG + Intronic
1072111669 10:92327019-92327041 GAGGGAGAGGAGAAGAATGAAGG - Intronic
1072776158 10:98196731-98196753 GGGGGACAAGAGTAGAAGGAAGG - Intronic
1072797192 10:98365106-98365128 GGGGATGAAGAGAAAAAGGAGGG + Intergenic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073578822 10:104645441-104645463 AAGGGTTAATCCAAGAAGGAGGG - Intronic
1073655130 10:105406157-105406179 GAGGCTTCAGAGAAAAGGGAAGG - Intergenic
1073694895 10:105853783-105853805 AAGGCTTTAGAGAAGAAGTAGGG + Intergenic
1073911224 10:108347079-108347101 GAAGGATGAGAGAAGAAAGAGGG + Intergenic
1073956021 10:108872309-108872331 GAGAGGTAAGGGAAGGAGGAGGG + Intergenic
1074020975 10:109582419-109582441 TAGGCTGAAGAGAAAAAGGAGGG + Intergenic
1074489813 10:113929566-113929588 GAGGGGTGAGAGAAGAGGGCTGG + Intergenic
1074746182 10:116534846-116534868 GAGGGTGGAGGGTAGAAGGAGGG - Intergenic
1074928223 10:118095446-118095468 GAGGGATGAGGGAAGAGGGAGGG - Intergenic
1075275255 10:121086969-121086991 GAGGGTCAAGGGCATAAGGAGGG + Intergenic
1076201546 10:128562771-128562793 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076555423 10:131318145-131318167 GAGAGGGAAGAGGAGAAGGAAGG + Intergenic
1076731997 10:132443914-132443936 GGGGGTTGAGAGGAGAGGGAAGG - Intergenic
1076932436 10:133541562-133541584 GATTATTAAGAGATGAAGGAAGG - Intronic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077392588 11:2306987-2307009 GAAGGTGAGGAGAAGAAAGAGGG + Intronic
1077797415 11:5507255-5507277 GTGGGCTATGAGAAAAAGGATGG - Intronic
1077802544 11:5555430-5555452 GAAGGGAGAGAGAAGAAGGAAGG + Intronic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078295477 11:10064568-10064590 AAAGGTTAAAAGAAAAAGGAGGG + Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078643741 11:13119233-13119255 AAGGGTTAAGAGAAGACATAAGG - Intergenic
1078968348 11:16373928-16373950 GAAGGGGAAGGGAAGAAGGAAGG + Intronic
1079637960 11:22769053-22769075 CAGGGTTAATAGAAAAAGTATGG + Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079934541 11:26600526-26600548 GAGAGAGAAGAGGAGAAGGAAGG - Intronic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080054349 11:27890219-27890241 GAGGAAGAAGAAAAGAAGGATGG - Intergenic
1080125873 11:28733011-28733033 GAGGGCCAAGAGATGAAGGGTGG - Intergenic
1080304118 11:30818358-30818380 GAGGTCTAGGAGAGGAAGGAAGG + Intergenic
1080491907 11:32773962-32773984 GAAGTTTAAGAGAAGACGGTAGG + Intronic
1080755169 11:35190331-35190353 TGGGGATAAGAGAATAAGGAGGG - Intronic
1080924360 11:36740474-36740496 GTGGGGTAAGAGTGGAAGGAGGG + Intergenic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081194419 11:40143702-40143724 GAGAATTATGAGAACAAGGATGG - Intronic
1081282329 11:41225093-41225115 GAGGATAGAGAGTAGAAGGATGG + Intronic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1081631654 11:44693786-44693808 GTGGCTTAAGTGAAGAAGGCAGG + Intergenic
1081692883 11:45089934-45089956 AAGACTTAATAGAAGAAGGAAGG + Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1082130187 11:48479116-48479138 TAGGGTTTATGGAAGAAGGAGGG - Intergenic
1082257614 11:50049911-50049933 GAGGGTAGAGAGTGGAAGGAGGG - Intergenic
1082563713 11:54650025-54650047 TAGGGTTTATGGAAGAAGGAGGG - Intergenic
1082677937 11:56131582-56131604 GAGGGTGGAGAGTAGAAGAAGGG + Intergenic
1082781090 11:57287954-57287976 GAGGGTCAAGGGAGGAGGGAGGG - Intergenic
1082805642 11:57448005-57448027 GAAGGAAAAGAAAAGAAGGAAGG + Intergenic
1082921643 11:58501413-58501435 GAGGCTTGGGAGAAGAGGGAAGG + Intergenic
1083153834 11:60810434-60810456 GAGGGAGAAGAGAAGACAGATGG - Intergenic
1084406544 11:68977153-68977175 AAGGGGGAAGAAAAGAAGGAAGG + Intergenic
1084919585 11:72458284-72458306 GAAGGGAAAGAAAAGAAGGAAGG + Intergenic
1085069528 11:73530593-73530615 GAGGGAAAAGTGAAAAAGGAAGG - Intronic
1085677620 11:78539197-78539219 AAGGGATAAGAGTAGAAGTAGGG + Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086165450 11:83772503-83772525 GAAGGGGAAGGGAAGAAGGAAGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086431448 11:86740605-86740627 CATGTCTAAGAGAAGAAGGAAGG + Intergenic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1086731832 11:90259565-90259587 GAGGATGAAGGGAGGAAGGAGGG + Intergenic
1086755347 11:90554859-90554881 GAAGGAGAAGAAAAGAAGGAGGG - Intergenic
1087296001 11:96374753-96374775 GAGGGTGGAGAGTAGGAGGAGGG - Intronic
1087332623 11:96800145-96800167 GAGGGTAGAGGGTAGAAGGAGGG - Intergenic
1087367742 11:97242611-97242633 GAGGTTGAAGAGAAAAGGGAAGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087732093 11:101790323-101790345 GAGGAAGAAGAGAGGAAGGAAGG + Intronic
1088181328 11:107115736-107115758 GTGGGTAAAGAGTGGAAGGAAGG + Intergenic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088394044 11:109347839-109347861 GAGGGAAAAGTAAAGAAGGAGGG - Intergenic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1088550797 11:111010487-111010509 GTGGATTTAGAGGAGAAGGATGG + Intergenic
1088552808 11:111031251-111031273 GAGGGTGAAGGGTGGAAGGAGGG + Intergenic
1088596100 11:111441458-111441480 GAGAGTTGAAAGAAGAAGGGTGG - Intronic
1088695931 11:112365892-112365914 TAGGGCTAGGAGAAGAAGGAAGG + Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089165824 11:116475698-116475720 AAGGGGTAAGAGCAGAAGCAGGG + Intergenic
1089359366 11:117875996-117876018 GATGGATAAGACAAGAAGGAGGG + Intronic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1089507732 11:118975329-118975351 GGGGTTTAAGAGTAGAAGGAGGG + Intronic
1089701081 11:120244287-120244309 GAGGGGCATGAGAAGAAGGCAGG + Intronic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1089876796 11:121730209-121730231 GAGGGTAAGGAAGAGAAGGAGGG - Intergenic
1090516274 11:127431054-127431076 GAGGCTGCAGAGAAAAAGGAAGG - Intergenic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1092084924 12:5748847-5748869 GAGGGTGAAGGGAAAAAGGAAGG - Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092227350 12:6756434-6756456 GAGGGAAAAGACAAGAGGGATGG - Intronic
1092621737 12:10279136-10279158 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
1092745085 12:11665707-11665729 GAGGGTTGAGGAAAGAAGAAAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093959080 12:25252537-25252559 GAGAGTTCAGAGAAGAGGGTAGG - Intergenic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094559024 12:31532353-31532375 GAGGTTTAAGACAAGAGGGTGGG + Intronic
1095136392 12:38609619-38609641 GAGGGTTGAGAGTGGGAGGAGGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095842748 12:46712311-46712333 GGAGGTGAAGAGAAGAATGAAGG - Intergenic
1095930248 12:47618462-47618484 GAGGAACAAGGGAAGAAGGAAGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096085217 12:48861151-48861173 GAAGGGTAGGAGAAGGAGGAAGG + Intronic
1096400651 12:51303511-51303533 GAGGGTTCAGAGAAAGAAGAAGG - Intronic
1096442900 12:51660912-51660934 GATGGGTAGGAGAAGAATGAAGG + Intronic
1096581230 12:52586815-52586837 GAGACTTAAGGGAAAAAGGAAGG - Intronic
1096670258 12:53194247-53194269 GAGGGTCCTGAGAAGAGGGAGGG - Exonic
1096919597 12:55069598-55069620 GAGGGTCATGAGAAGAAGCCAGG - Intergenic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097331675 12:58338457-58338479 GAGGGGTAAGGAAAGAAGCAGGG - Intergenic
1097635936 12:62122069-62122091 GAGGGTGAAGGGTGGAAGGAGGG + Intronic
1098230351 12:68366719-68366741 AAGGTATGAGAGAAGAAGGAAGG - Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098685004 12:73408792-73408814 GAGGGAGAAGAGAAGAAGAAAGG + Intergenic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1098734435 12:74081427-74081449 TAGGGTTAAGGAAAGAATGAGGG - Intergenic
1098833377 12:75390939-75390961 GAGGGAGGAGAGAAGAGGGAGGG - Intergenic
1098864363 12:75745235-75745257 TAGGGATAAGGGAAGAAGGGTGG - Intergenic
1099111972 12:78573125-78573147 GAGGGGTAAGTGCAGAAGTAGGG - Intergenic
1099300770 12:80891779-80891801 GAGGTGTAAGTGGAGAAGGAGGG + Intronic
1099393544 12:82110074-82110096 GAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1101288300 12:103339348-103339370 GAGGGTGGAGGGTAGAAGGAGGG - Intronic
1101348217 12:103905426-103905448 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348265 12:103905556-103905578 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348278 12:103905606-103905628 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348304 12:103905673-103905695 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101364621 12:104060289-104060311 GAGAGTTTGGAGAAGAGGGATGG - Intronic
1101683831 12:106996600-106996622 GAGGATGCAGAGAAAAAGGAAGG - Intronic
1102804652 12:115769107-115769129 CAGGGTTAAGGGAACAAAGAAGG + Intergenic
1102957125 12:117066046-117066068 GTGTGTGAAGAGAAGAGGGAGGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103366969 12:120390572-120390594 GAGGGAAGAGGGAAGAAGGAGGG + Intergenic
1103743346 12:123106107-123106129 TGGGGTGAAGAGAAGAAGCAGGG - Intronic
1103971677 12:124676359-124676381 GAGAGTGAAGGAAAGAAGGAGGG + Intergenic
1104128167 12:125867139-125867161 GAGGGCTAAGAAAATAAGGCTGG - Intergenic
1104134378 12:125923445-125923467 GAGGGAGAAGAGATGATGGATGG + Intergenic
1104179459 12:126364627-126364649 GGGGGTTCAGGGAAGAAGGGTGG - Intergenic
1104195903 12:126537784-126537806 GAGGGTGGAGGGTAGAAGGAAGG + Intergenic
1104305349 12:127605532-127605554 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1104710863 12:130984881-130984903 GAGAGAGAAGAGAAGAAAGAAGG - Intronic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1105683345 13:22752267-22752289 GAGGGTAGAGAGGGGAAGGAGGG - Intergenic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1105957403 13:25297007-25297029 GAGGTTTTAAGGAAGAAGGAAGG + Intergenic
1106163697 13:27223156-27223178 GAGGGTGAAGGGTAAAAGGAGGG + Intergenic
1106407689 13:29488082-29488104 GAGGGACAAGAGAGGAAGGGGGG - Intronic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106712929 13:32357978-32358000 GACAGTTAAGAGAAGAAAGAGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107236590 13:38177766-38177788 GAGGGTTCAGGGTAGGAGGAGGG + Intergenic
1107387796 13:39931396-39931418 AAGTGAGAAGAGAAGAAGGAAGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107533764 13:41308866-41308888 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1107781972 13:43913106-43913128 GAGGGTTCAGGAAGGAAGGAAGG + Intergenic
1107966526 13:45603033-45603055 GAGGCTTAAGACATGGAGGAGGG + Intronic
1107999993 13:45897180-45897202 GAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1108111498 13:47078621-47078643 GAGGGTTAAGAATGGGAGGAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109476430 13:62885675-62885697 GAGGGTGGAGAGAGGAAGAAGGG - Intergenic
1109476913 13:62891423-62891445 GAGGGTAAAGGGGAGAAAGAAGG - Intergenic
1109718905 13:66252317-66252339 GAAGGGAAAGAGAAGAAGCAGGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109809046 13:67485114-67485136 CAAGGATAAGAGAAGAAAGATGG - Intergenic
1109878968 13:68446036-68446058 AAGGGTTAAGAGTAGAAGTCAGG + Intergenic
1110207767 13:72937080-72937102 ACGGGTTAAAAGAAGAAGGCTGG - Intronic
1110255928 13:73433957-73433979 GAGGGGGAGGAGAAGAGGGAGGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110551089 13:76812285-76812307 GAAGGTTATCAGAAGAAGCAGGG + Intergenic
1110741238 13:78999977-78999999 GAGGGTGAAGACATGAAAGATGG - Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111554874 13:89867643-89867665 CAGGGTTGAGAGTAGAAGAAAGG - Intergenic
1111970460 13:94909089-94909111 GGGGGTTAAGGGTAGAAGCAGGG - Intergenic
1112005680 13:95251718-95251740 GAGAGTTTAGAGAACAAGGAAGG + Intronic
1112144453 13:96681822-96681844 GAGGCATGAGAGAACAAGGATGG - Intronic
1112584507 13:100706288-100706310 GAGAGGAAAGAAAAGAAGGAAGG - Intergenic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1113159563 13:107364889-107364911 GAGGGAGAGGAGAAGAAAGAAGG - Intronic
1113186262 13:107688943-107688965 GATGGTGATGAGAAGCAGGAGGG + Intronic
1113206025 13:107917028-107917050 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113411121 13:110090802-110090824 GAGGATTAAGAAAAGTGGGAGGG - Intergenic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1113796529 13:113061731-113061753 GAGGGGAAAGGGAAGAGGGAGGG - Intronic
1113957528 13:114107325-114107347 GAGGGTCAGGACACGAAGGAGGG - Intronic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114193588 14:20458717-20458739 GAGGGAGAAGAAAAGAAAGATGG + Intronic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114487499 14:23071615-23071637 GAGGGGAAAGAAAAGAGGGAGGG + Intronic
1114503243 14:23187723-23187745 CATAGTTACGAGAAGAAGGATGG - Intronic
1114615966 14:24068637-24068659 GATGGGGAAGAGGAGAAGGAGGG + Exonic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1114894754 14:26973679-26973701 GTGGCTTAAGACAAGAAGGTGGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1116265808 14:42688098-42688120 GAGGGCTCAGAGAAGAAGGTAGG - Intergenic
1116382078 14:44282203-44282225 GAGGATTAAGTGAAGACAGAAGG + Intergenic
1116537153 14:46046974-46046996 GAGGGTGAAATGAAGAAGGAGGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116675258 14:47898491-47898513 GAGGGTGAAGGGTGGAAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117084570 14:52186109-52186131 GAGGGGAAAGTGGAGAAGGAGGG - Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117108508 14:52424098-52424120 GAAGGTTAAAAGTAAAAGGATGG - Intergenic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118465095 14:66023653-66023675 GATGGAGGAGAGAAGAAGGAAGG - Intergenic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118664347 14:68050696-68050718 GAGGGGGAAGAGAAGAGGGCAGG - Intronic
1119463832 14:74836522-74836544 GAAAGTGAAAAGAAGAAGGAAGG - Intronic
1119816238 14:77570915-77570937 GAGGGATAAGAGACTATGGAAGG + Intronic
1120025665 14:79581270-79581292 GAGTGTTGAGAGAAGCAGTAAGG - Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121055832 14:90851670-90851692 AAGGGTTCAGGGAAAAAGGAAGG + Exonic
1121103924 14:91268645-91268667 GGAGGTTGAGAGTAGAAGGATGG + Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121395164 14:93615371-93615393 GAGGGTGGGGAGAAGAGGGAGGG - Intronic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121991969 14:98567052-98567074 GAGGGATGAGAGAAGAAAGAAGG - Intergenic
1122401096 14:101467866-101467888 GAGGATGGAGAGAAGAGGGATGG + Intergenic
1122486406 14:102084847-102084869 GAGGAAGAAGAAAAGAAGGATGG - Exonic
1122819749 14:104335475-104335497 CGGGGTTGAGAGAAGAGGGAGGG - Intergenic
1122868400 14:104621368-104621390 GAAGGAAAAGAGAGGAAGGAAGG + Intergenic
1123678649 15:22739497-22739519 GGGGGAGAAGAGAGGAAGGAAGG - Intergenic
1123736381 15:23188208-23188230 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124191607 15:27582373-27582395 GAGGGCTATGAGAAGAAGGGAGG - Intergenic
1124259727 15:28178082-28178104 GAGGGTTGGGGGAAGAAGCAGGG - Intronic
1124287087 15:28411185-28411207 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124295614 15:28500444-28500466 GAGAGGGAAGAGAAAAAGGAAGG + Intergenic
1124330855 15:28813778-28813800 GGGGGACAAGAGAGGAAGGAAGG - Intergenic
1125403254 15:39326755-39326777 GAGAGTTATGAGCAGATGGAGGG - Intergenic
1126097152 15:45097825-45097847 GAGGGATGAGAGAGGAAGGAGGG - Intronic
1126907542 15:53384197-53384219 GAGGTTGAAGAGAGGAAAGAAGG - Intergenic
1126964806 15:54039891-54039913 GGGGGTCAAGGGAAGAAGCAGGG - Intronic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127625356 15:60775094-60775116 AAGGGTTGAAAGAAGAAAGAAGG - Intronic
1127982921 15:64047173-64047195 GGGGGTGAAGGGAGGAAGGAAGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128490808 15:68141336-68141358 GAGAATTAAGAAAGGAAGGAAGG - Intronic
1128496148 15:68199744-68199766 GAGGGAGAAGAGACTAAGGATGG - Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1128965539 15:72053651-72053673 GAGGGTGAAGGGTGGAAGGAAGG + Intronic
1129004729 15:72363060-72363082 GAGGGGGAAGAGAAGAAAGTGGG - Intronic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129379065 15:75154226-75154248 GAGGATTGGGAGAAGAAAGAGGG - Intergenic
1129506017 15:76082045-76082067 GAGGATGAAGAGATGAAGCATGG - Intronic
1129933049 15:79428256-79428278 GAGGGAGAAGAAAGGAAGGAGGG - Intergenic
1130058378 15:80550227-80550249 GAGGGTGAATGGAACAAGGATGG + Intronic
1130226044 15:82058992-82059014 GAGGGGGAGGAGGAGAAGGAGGG - Intergenic
1130680939 15:85996207-85996229 GAGGGTGAAGTGAATAAGGATGG - Intergenic
1130713355 15:86306336-86306358 GAAGATAAAGAGTAGAAGGATGG - Intronic
1130749996 15:86701678-86701700 GAGGAGGAAGAGAAGAGGGAAGG - Intronic
1130767613 15:86887940-86887962 GAGGGTTTAGAGTAAATGGAAGG - Intronic
1131600779 15:93846679-93846701 GAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1131663390 15:94543062-94543084 GAGGGTGAAGAAGTGAAGGAAGG + Intergenic
1131779791 15:95843831-95843853 CAGGGTGAAGGGAAGATGGATGG - Intergenic
1132191510 15:99866303-99866325 GAGGTCTGAGAGAAGAAGAAAGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1133031735 16:3014311-3014333 GAGGGCTCAGAAGAGAAGGAAGG - Exonic
1133037764 16:3044005-3044027 GTGGTTTAAGAGAGCAAGGAGGG - Intergenic
1133431669 16:5742327-5742349 GAAAGTTAGGAGAGGAAGGAAGG - Intergenic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1133552188 16:6867416-6867438 GAGGATTAAGGGAAGAAAGGGGG + Intronic
1133611103 16:7434168-7434190 GTGGTATAAGAGATGAAGGAGGG + Intronic
1133617849 16:7495448-7495470 GAGGCTGCAGAGAAAAAGGATGG - Intronic
1134007168 16:10825745-10825767 GAGGGCCAAGGGAAGAAGGAGGG + Intergenic
1134023696 16:10939284-10939306 GAGGGGTAAGAGGGGAAGCAGGG - Intronic
1134318242 16:13139425-13139447 GAAGAGGAAGAGAAGAAGGAAGG - Intronic
1134423092 16:14112568-14112590 GTGGAATAAGAGAAGAAGCAGGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135054982 16:19224327-19224349 GATGGCTAAAGGAAGAAGGAAGG + Intronic
1135243676 16:20835149-20835171 GAAAGATAAGAAAAGAAGGAAGG - Intronic
1135495735 16:22949652-22949674 GAGGGGAAAGAGGGGAAGGAAGG + Intergenic
1135525066 16:23207940-23207962 GGGGGTAAAGAGAAAAAGAATGG - Intronic
1135526620 16:23217950-23217972 AAGGGTGAAGTGGAGAAGGAGGG - Intergenic
1135548805 16:23382916-23382938 GAGGCTTAAGAGGTGAAGTAAGG + Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135910619 16:26557555-26557577 GAGGGGTAAGGAAAGAAGGGGGG - Intergenic
1135938765 16:26803102-26803124 GAGGGAGAAGGGAAGAAGAAGGG + Intergenic
1135969800 16:27063990-27064012 GCGGGGTGAGAGAAGAAGGAGGG - Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1135976009 16:27109406-27109428 GAGGGAAAAGGGAAGAAGGCAGG + Intergenic
1136151980 16:28356843-28356865 GAGGGGGAGGAGAAGAAGAAAGG + Intronic
1136394150 16:29983793-29983815 GAGGGTTAAGGGGAGCAGGCAGG - Intronic
1136462536 16:30420600-30420622 GAGGGCTTAGAGGGGAAGGATGG + Intronic
1136488084 16:30585854-30585876 GAAGGCCAGGAGAAGAAGGAAGG + Intergenic
1136595596 16:31247366-31247388 GAGGGTCAAGGGCAGGAGGATGG - Intergenic
1137552588 16:49450292-49450314 TAGGGTTAAAAGTAAAAGGATGG - Intergenic
1137622418 16:49884638-49884660 GAGGATAAAGAAAGGAAGGAAGG + Intergenic
1137746863 16:50828591-50828613 GAAAGAGAAGAGAAGAAGGAAGG - Intergenic
1138146764 16:54619625-54619647 GATGGTTAAAAGAAAAAGGCAGG - Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138993704 16:62422507-62422529 GAAGGTTAAGACAAGAACAAGGG + Intergenic
1139094713 16:63691610-63691632 GTGGATTAAAAGAAGAAAGATGG + Intergenic
1139209946 16:65067713-65067735 AAGGGAGAAGAGAAGAAGAAGGG + Intronic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139732883 16:68962384-68962406 GATGGTTAACAGAAGTGGGAAGG - Intronic
1140055506 16:71522168-71522190 GCTGGTTAAGAGGAGAAAGAAGG - Intronic
1140204476 16:72922303-72922325 GATGGTTAGGAGAGGATGGAGGG - Intronic
1140788753 16:78369014-78369036 AAGAGTTGAGAGAGGAAGGAAGG - Intronic
1140895884 16:79323771-79323793 GAGGGTTAAGGAAATAACGAGGG + Intergenic
1140964404 16:79950885-79950907 GAGGTAAAAGAGAAGAATGAGGG + Intergenic
1141636610 16:85317330-85317352 GAGAGCCAAGAGGAGAAGGAGGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1141932224 16:87213521-87213543 GATGGTGAGGAGAAGAAGGATGG + Intronic
1142675011 17:1508223-1508245 GAGGCTTCAGAAAAAAAGGAGGG + Exonic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143021316 17:3918299-3918321 GAGGGAGGAAAGAAGAAGGAGGG + Intergenic
1143305941 17:5946797-5946819 AAGGGTGGAGAGGAGAAGGATGG + Intronic
1143478769 17:7217276-7217298 GAGGGGTGAGAGGGGAAGGAGGG + Intronic
1143704442 17:8687318-8687340 GAGGGTTAAGAGAGGAGGGGAGG - Intergenic
1143794814 17:9327952-9327974 GAGGGAGAAGGAAAGAAGGAAGG - Intronic
1143844324 17:9762272-9762294 GGGAGTTCAGAGAAGCAGGAAGG + Intergenic
1144122941 17:12174220-12174242 GAGCGTGAAGAGAAGAAGTAGGG + Intergenic
1144185322 17:12790461-12790483 GAGGGGTGGGAGAGGAAGGAAGG + Intronic
1145016275 17:19400425-19400447 GAGGGTGAGGACAGGAAGGAAGG - Intergenic
1146411278 17:32587748-32587770 GAGGCTGAAGAGCAGAGGGAGGG - Intronic
1147413742 17:40273436-40273458 GAGGGGTAAGAGACAAAGCAAGG + Intronic
1147415171 17:40283685-40283707 GAGGCTAAAGAAAAGAAGGGTGG + Exonic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148029111 17:44607987-44608009 GTGGGAGAAGAGGAGAAGGAGGG - Intergenic
1148237021 17:45975813-45975835 GAGGGGTAAGAGAAACAGGAAGG + Intronic
1148653990 17:49269660-49269682 GAGGGCTAAACAAAGAAGGACGG - Intergenic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148978360 17:51549099-51549121 GAGGGTTAATGGTAGAAGGAGGG - Intergenic
1149416915 17:56469245-56469267 GAGGGGAGAGAGAAGAAGTAGGG - Intronic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1150073629 17:62173594-62173616 GGGAGTTGAGAGAAGAAAGATGG - Intergenic
1150332889 17:64308653-64308675 AAGGGTGATGAGAAGAAGAAGGG - Intergenic
1150979237 17:70123001-70123023 GAAATTTAAGAGCAGAAGGAGGG - Intronic
1151878626 17:76881427-76881449 GAGGGTCCAGGGAAGAGGGATGG + Intronic
1152267847 17:79306654-79306676 GAGGGTGCAGGCAAGAAGGAAGG + Intronic
1153004395 18:484375-484397 GAGGGTTAAGATGAGAAGCAGGG - Intronic
1153237267 18:3000091-3000113 GAGGGGAAAGAGGGGAAGGAGGG + Intronic
1153416685 18:4853521-4853543 GAGGAGGAAGAGAACAAGGAGGG + Intergenic
1154083695 18:11281507-11281529 GATGCTTAAGAGATGAAGCAGGG - Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1155064612 18:22257663-22257685 GAGGACCCAGAGAAGAAGGATGG + Intergenic
1155231665 18:23780315-23780337 CAGGGTGAAGGAAAGAAGGAAGG + Intronic
1155392570 18:25351667-25351689 GTGGGTTAAGAAAAAAAGGGTGG - Intronic
1155541499 18:26873160-26873182 GTGGGTTGAGAGAAGAAGTCAGG - Intergenic
1156048791 18:32907113-32907135 GAGGGGCTAGAAAAGAAGGAGGG - Intergenic
1156048795 18:32907131-32907153 GAGGGGCTAGAAAAGAAGGAGGG - Intergenic
1156411014 18:36828635-36828657 GAGGGTGTGGAGGAGAAGGAAGG - Intronic
1156466266 18:37349425-37349447 GCGGGTTTAGGGAGGAAGGAGGG + Intronic
1157526154 18:48384133-48384155 AAAGGTGAAGGGAAGAAGGATGG + Intronic
1157602134 18:48900496-48900518 GAGGGTGGAGAGAAGAAAGTGGG + Intergenic
1157618741 18:49003246-49003268 GAGGGGGAAGGGAAAAAGGAAGG - Intergenic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1158155723 18:54423371-54423393 GAGTGTGAAGGGAAAAAGGAGGG + Intergenic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161415776 19:4145593-4145615 GAGGGGAAGGAGAAGAGGGAAGG + Intergenic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1161797264 19:6394201-6394223 GAGGGCTCAGAGAAGAGGGGAGG + Intergenic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1162038163 19:7953523-7953545 GAGGGGGATGAGAGGAAGGAGGG - Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162071898 19:8157912-8157934 GAGGAGAAAGAGAGGAAGGAAGG + Intronic
1162189397 19:8932839-8932861 GGAAGTTAAGAGAGGAAGGAGGG + Intronic
1162984105 19:14258321-14258343 GAGGGGGAGGAGAAGAAGAAGGG - Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163293203 19:16394215-16394237 GATGTTTAAGATGAGAAGGAAGG + Intronic
1164249853 19:23467070-23467092 GAGGGATAGGAGAAAAAAGAAGG - Intergenic
1164249860 19:23467125-23467147 GAGGGATAGGAGAAAAAAGAAGG - Intergenic
1164250128 19:23468693-23468715 GAGGAGGAAGAGGAGAAGGAGGG - Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164714994 19:30384679-30384701 GAGGGTTGAGAGAGGAGGAATGG + Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165274435 19:34735560-34735582 GAGGGTTAAGGGCAGATGCAGGG - Intronic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166026703 19:40092325-40092347 AAAGGTTAAGAGTAAAAGGATGG + Intergenic
1167005956 19:46776864-46776886 GAAGAGGAAGAGAAGAAGGAAGG - Intronic
1167130472 19:47582095-47582117 GAGGTGGAAGGGAAGAAGGAAGG - Intergenic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
926796489 2:16623661-16623683 GAGGGTTAAGGAATGAAAGAGGG - Intronic
926831743 2:16970858-16970880 GAAGGTCAAGAGAGGAAGAAAGG - Intergenic
927008475 2:18877420-18877442 GAGGGTGGAGGGTAGAAGGAGGG - Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
928608381 2:32965482-32965504 CAGGGTTTAGACAGGAAGGAGGG - Intronic
928735350 2:34282453-34282475 GAGACTTCGGAGAAGAAGGAAGG - Intergenic
928921719 2:36534286-36534308 GAGGGATGAGAAAGGAAGGAGGG + Intronic
929113414 2:38424432-38424454 GAAGGTGAAGAGGAGAAGCAAGG + Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929292487 2:40209416-40209438 GAGAGTTAAGAGTAGAGTGAGGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930110575 2:47675449-47675471 GAGGCTTCTGAGAAGCAGGAGGG - Intergenic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930544670 2:52751340-52751362 GAGGGTGGAGAGTGGAAGGAGGG - Intergenic
931652849 2:64484110-64484132 GTGGTTTTACAGAAGAAGGAGGG - Intergenic
931782411 2:65590168-65590190 GAAAGTAAAGAGAAGAAGAATGG - Intergenic
931826330 2:66004291-66004313 GAGAGGGAAGAGAGGAAGGAAGG - Intergenic
932413229 2:71559391-71559413 GAGGGGTGGGAGAGGAAGGAAGG - Intronic
932554421 2:72807807-72807829 GATGGTTCAGAGGAGAAGTAGGG + Intronic
932583128 2:73005504-73005526 GATGGTTATGAGAGGAAGTAAGG + Intronic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
933012179 2:77080283-77080305 GAGGCTGAAGAGAAGAATAAAGG - Intronic
933545479 2:83706059-83706081 GAGGGTGGAGGGTAGAAGGAGGG - Intergenic
933553618 2:83806167-83806189 GTGGGTTTAGGGAAGAAGCATGG + Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935070918 2:99692685-99692707 TAGGGTTCAGAGAAGAGGGAAGG - Intronic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935950490 2:108324237-108324259 GAGGGGAAGGAGTAGAAGGATGG + Intergenic
936530827 2:113276258-113276280 GAGGGTTCAGAAAAGAAACAGGG + Intronic
936561059 2:113540450-113540472 GAGGCTGAAGAAAAGAAGAATGG - Intergenic
936609695 2:113989646-113989668 GAGGGCTAAGGGGAGAAGCAGGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
936985507 2:118308677-118308699 GAGGAGTAGGAGAAGAGGGAGGG + Intergenic
937242220 2:120469567-120469589 GAAGGAAAAGGGAAGAAGGAAGG + Intergenic
937664922 2:124475746-124475768 GCAGGTTAAGAGCAAAAGGATGG - Intronic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
937757201 2:125554705-125554727 GAGGGTTGAGAGATGGAGGTGGG - Intergenic
937859950 2:126699853-126699875 AAGGCTTTAGAGAAGAAGGGAGG + Intergenic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938117339 2:128611066-128611088 GAGACTTAAGAAAAGAAGGAAGG - Intergenic
938266305 2:129930700-129930722 GAGCGGGAAGAAAAGAAGGAAGG - Intergenic
938625531 2:133104904-133104926 GAAGGTTAATAGCAAAAGGATGG - Intronic
938941839 2:136176472-136176494 TGGGTTTAAAAGAAGAAGGAAGG + Intergenic
939011838 2:136855774-136855796 GAGTGATAAGAGAAGAATGAGGG - Intronic
939193958 2:138949480-138949502 GAGAGTTAACAGAATAAAGAAGG + Intergenic
939781567 2:146456760-146456782 GAGGATGAAGAGTGGAAGGAGGG - Intergenic
939790162 2:146562375-146562397 GAGAGAGAAGAGAAGAAGAAAGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940092729 2:149938947-149938969 GAGGCTGCAGAGCAGAAGGAGGG - Intergenic
940730776 2:157388506-157388528 GAGGGTGGAGGGAGGAAGGAGGG - Intergenic
940897363 2:159093742-159093764 GAGGCTTAAGAGAAGAGGGAGGG - Intronic
941278155 2:163516939-163516961 GAGAGTTAACAGAAGATGTAGGG - Intergenic
941493952 2:166177844-166177866 GAAGTTTGAGAGTAGAAGGATGG - Intergenic
941819382 2:169828605-169828627 GAGGGTTGAGGGAGGAGGGAAGG + Intronic
941898308 2:170653071-170653093 GAGGATGAAGAAAAAAAGGAAGG - Exonic
942489412 2:176474765-176474787 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
942543023 2:177034460-177034482 GAGGGAAGAGAGAAGACGGAAGG + Intergenic
942641184 2:178062222-178062244 TAGGGTTATGATAAAAAGGAGGG + Intronic
943343066 2:186704842-186704864 GAGGCTCAAGAGAAGAGAGAGGG + Intronic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943800590 2:192052755-192052777 AGGGGTTAAGAGAAGAAGAAAGG - Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944136627 2:196406637-196406659 GTGGGTTCAGAGAAGAAGGTTGG - Intronic
944430375 2:199626630-199626652 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
944778285 2:202991649-202991671 GAGAGTTAAGAGGAGAAAAAAGG - Intronic
945945806 2:215994611-215994633 GAAGAAGAAGAGAAGAAGGAGGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946427716 2:219608313-219608335 GAGGAGGAAGAGGAGAAGGAGGG + Exonic
946504100 2:220280685-220280707 AAGGGTTATGAGGAGCAGGAAGG - Intergenic
946576056 2:221077087-221077109 GGAGGTTAAGAGAAGGAGAAAGG - Intergenic
946661991 2:222011002-222011024 GAGGGTGGGGAGCAGAAGGAAGG + Intergenic
946676828 2:222169227-222169249 GAGGGGTCTGGGAAGAAGGATGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946898736 2:224352357-224352379 GAGGAAGAAGAGAGGAAGGAGGG + Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947219354 2:227777930-227777952 GAGGGAAGAGAAAAGAAGGAAGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947836460 2:233179486-233179508 GAGGCTTTAGAGAAAGAGGAGGG + Intronic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
948141919 2:235679773-235679795 GAGATTTTAGAGAATAAGGATGG + Intronic
948695715 2:239732174-239732196 GAGGGTGGAGGGAGGAAGGAAGG - Intergenic
948774297 2:240274206-240274228 AATGGTTAAGAGCAGAGGGAGGG + Intergenic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
1169389350 20:5176959-5176981 GAAAGTTAAGAGAAAAAGGCAGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170107806 20:12770648-12770670 GAGGGTGGAGAGTGGAAGGAGGG + Intergenic
1170264031 20:14444992-14445014 GAGGGGCAAGAGTAGAAGCAAGG - Intronic
1170392592 20:15891495-15891517 GAGAGTAAAGAGTAGAAGCAGGG + Intronic
1173235129 20:41238412-41238434 GCTGGAGAAGAGAAGAAGGAAGG + Intronic
1173372056 20:42445482-42445504 GAGGCCTAAGAAAATAAGGATGG - Intronic
1173465028 20:43274027-43274049 GAGGGTTGGAAGAAGAGGGAGGG + Intergenic
1173770341 20:45651058-45651080 GAGGGTGAAGGGTGGAAGGAGGG - Intronic
1174045361 20:47729256-47729278 GAGGGTTCAGAGAGAAGGGAAGG + Intronic
1174434980 20:50499846-50499868 GAGGGTGAAGACCAGCAGGAAGG - Intergenic
1174474074 20:50783536-50783558 GAGGGTTTAGAGGTGGAGGAAGG - Intergenic
1174531165 20:51215462-51215484 GAGGGCTAGAAGAAGAAGGCAGG + Intergenic
1174655376 20:52167538-52167560 GAAGGGGAAGAGGAGAAGGAGGG - Intronic
1174674380 20:52339478-52339500 GCAGGTTCAGAGAAGAAGCAAGG + Intergenic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175891446 20:62317810-62317832 GAGGGGTAAGAAAAGAATAAAGG + Intronic
1177060264 21:16364485-16364507 GAGGAGAAAGAGGAGAAGGAAGG - Intergenic
1177211952 21:18082497-18082519 GAGGGTTAAGATAGGAAGATGGG + Intronic
1177346383 21:19877593-19877615 GAGGCTGAAGAGAAAAGGGAAGG + Intergenic
1177853563 21:26377080-26377102 GAGGGTATAGGGAAGAGGGAGGG + Intergenic
1177939293 21:27389342-27389364 GAGGGCTCAGAGAGGAAGAAAGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178216907 21:30609022-30609044 AAGGGATAATAGAAGAAGAATGG + Intergenic
1178284138 21:31310807-31310829 GCAGGATGAGAGAAGAAGGATGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178876758 21:36419955-36419977 GAGGGGTAAGAGAAAATGTAGGG + Intergenic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1179425557 21:41275509-41275531 GACGATTAAGACAAGGAGGATGG - Exonic
1180148996 21:45938121-45938143 GATGGTTAAGAGAAGAGGGTAGG + Intronic
1180172055 21:46064760-46064782 GAGGGAGGAGGGAAGAAGGAAGG + Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181977579 22:26741900-26741922 GAAGGAGAAGAGAGGAAGGAAGG - Intergenic
1182099529 22:27648180-27648202 GAGGGGGAAGAGCAAAAGGAAGG + Intergenic
1182386628 22:29948647-29948669 GAGGGATAATATAAAAAGGATGG + Intronic
1182432862 22:30310870-30310892 GAGGGTGATAAGAAGAGGGAAGG - Intronic
1182442134 22:30370800-30370822 GAGGCTGAAGGGCAGAAGGATGG + Exonic
1182836499 22:33346243-33346265 GAGAGAGAAGAGAGGAAGGAAGG - Intronic
1183177750 22:36237015-36237037 GAGGGAGAAGAGGAGCAGGAGGG + Intronic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183640768 22:39091013-39091035 GAGGGTTCTGAGAACACGGAAGG + Intergenic
1183925046 22:41199835-41199857 GTGGATCAAGAGAAGAAGCAAGG + Intergenic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184946979 22:47810780-47810802 GAGGGAAAAGGGAAGCAGGAGGG - Intergenic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
1185214325 22:49589843-49589865 GAGTGGGAAGAGAAGAAGGATGG - Intronic
949491004 3:4588952-4588974 GACGGTTTAGAGCAGAATGAGGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950903851 3:16520080-16520102 GAGCGTGAAGGGAAGCAGGAGGG + Intergenic
951046184 3:18041076-18041098 GAGGGTGGAGAGGACAAGGAGGG - Intronic
951284885 3:20798312-20798334 GAGGGTGGAGAGTGGAAGGAGGG - Intergenic
951330612 3:21363971-21363993 GAGGAATACAAGAAGAAGGAAGG + Intergenic
951412265 3:22379493-22379515 GAGGGGAGAGGGAAGAAGGAAGG + Intergenic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951648520 3:24921629-24921651 GAGAGTTAAGAGGAGATGGGGGG - Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952145647 3:30529060-30529082 GAGAGATAAGAGAAGAAGCAGGG - Intergenic
952160439 3:30688215-30688237 AATGGCTAAGATAAGAAGGAAGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952560500 3:34587249-34587271 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
952723881 3:36561616-36561638 GAGGTCTAGAAGAAGAAGGATGG - Intergenic
952937787 3:38413648-38413670 GAGGGAGGAGAGATGAAGGAGGG - Exonic
953014177 3:39056933-39056955 GATTGTAATGAGAAGAAGGAGGG + Intronic
953030052 3:39173735-39173757 GAGGGTGAAGGGTGGAAGGAAGG - Intergenic
953439263 3:42904145-42904167 GAAGGAGAAGGGAAGAAGGAAGG - Intronic
953439287 3:42904229-42904251 GAAGGAGAAGGGAAGAAGGAAGG - Intronic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
953837432 3:46359007-46359029 CAGGGCTGAGAGGAGAAGGAGGG + Intronic
954366033 3:50146691-50146713 GAGGGATAAGAGACAGAGGAGGG - Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954773876 3:52999015-52999037 AAGGGGTAAGAGGAGATGGAGGG - Intronic
955483576 3:59413679-59413701 GAGGGAAAAGAAAAGAAGGGAGG - Intergenic
955496660 3:59540636-59540658 GAGGGTAAAGGGAGGAAGGAAGG + Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
956178207 3:66494016-66494038 GAAGGGGAAGGGAAGAAGGAAGG + Intronic
956186633 3:66568831-66568853 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
956578032 3:70777445-70777467 GAGGGTGGAGGGTAGAAGGAGGG + Intergenic
956652082 3:71513500-71513522 GTGGGGTAAGAGAAGGAGCAGGG - Intronic
956875590 3:73459495-73459517 GAGGGTGAAGGGTAGAAGGAAGG - Intronic
956988259 3:74730174-74730196 GAGAGTTAAGGAAAGGAGGAAGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957507435 3:81140912-81140934 AAGGGAGAAGGGAAGAAGGAAGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957877337 3:86164785-86164807 GCAGGTTCAGAGAAGAAGTATGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
959187487 3:103064504-103064526 GAAGGATAAGAGAAGAAGAATGG - Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959554282 3:107698939-107698961 GACGGATTAGAAAAGAAGGATGG + Intronic
959830362 3:110854273-110854295 GGGGGTTAAGAGTAAAAGCAGGG - Intergenic
960043438 3:113173350-113173372 GGAGGGGAAGAGAAGAAGGAGGG + Intergenic
960298932 3:115977984-115978006 GAGGAGGAAGAGAGGAAGGAAGG - Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960633021 3:119752355-119752377 GAGGGTTGAGATGAGAGGGAAGG + Intronic
960715495 3:120570997-120571019 GAGGGGTAAGAGAGAAAGGAGGG + Intergenic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
960948642 3:122984126-122984148 GAAGGAGAAGAGAAGAAGGAAGG - Intronic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
962430673 3:135316379-135316401 GATGGTGAAGAGAAAAATGAAGG + Intergenic
962563087 3:136628558-136628580 GGGGTTTAGGAGAAGAAGAAGGG - Intronic
962769698 3:138600923-138600945 GAGGGGGAGGAGGAGAAGGAGGG + Intergenic
962813528 3:138978830-138978852 GAGGGTGGAGGGTAGAAGGAGGG + Intergenic
963096290 3:141544989-141545011 GAGGGTGGAGAGTAGGAGGAGGG + Intronic
963933843 3:151032582-151032604 GAGGGTGGAGGGCAGAAGGAGGG + Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
964382964 3:156116287-156116309 GGGAGTCAAGGGAAGAAGGAGGG - Intronic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964590696 3:158360246-158360268 GAGGATGAAGAGAAGATGGGAGG - Intronic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965179196 3:165379380-165379402 GAGGGTAGAGAGAGAAAGGAAGG - Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965787520 3:172351742-172351764 GAGGGGTATGAGAGGAAGAAAGG + Intronic
965961746 3:174437551-174437573 GAGAGGGGAGAGAAGAAGGAGGG - Intergenic
965991334 3:174822241-174822263 GAGTGGGAAGATAAGAAGGAAGG + Intronic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966147183 3:176824996-176825018 GAGAGTAAAGAAAAGAGGGAAGG + Intergenic
966226397 3:177602799-177602821 GAGCGATAAGAAAAGGAGGAAGG + Intergenic
966681581 3:182647030-182647052 TAGGGATAAGAGCAGAAGCAGGG - Intergenic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967277367 3:187789886-187789908 GAGGAAGAAGAGAGGAAGGAAGG + Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967643204 3:191893459-191893481 GGAGGAAAAGAGAAGAAGGATGG - Intergenic
968282445 3:197487273-197487295 GAGGGTACAGGGAAGCAGGAGGG + Intergenic
969387776 4:6867305-6867327 GAGTGTCCAGAGTAGAAGGACGG + Intronic
970209920 4:13698516-13698538 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
970368808 4:15387549-15387571 GAAGGACAAGAGAAGAAAGAGGG + Intronic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970801010 4:19973742-19973764 GAGGGATGAGAGATGAAGGAAGG + Intergenic
971201123 4:24509974-24509996 GAGGGTTAAGGGAAGAAATCTGG + Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972220321 4:36947766-36947788 GAGGGTTAAGCAAGGAAGGAGGG - Intergenic
972656581 4:41069190-41069212 GAGAGTAAAGGCAAGAAGGAAGG + Intronic
972787868 4:42344482-42344504 GGGGGTTCAGAGAAGGAGGCTGG + Intergenic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973567602 4:52204003-52204025 GAGGATAAAGGGAAGAAGGAAGG - Intergenic
973838783 4:54839741-54839763 GAGGGTGGAGAGTGGAAGGAGGG + Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974217889 4:58923155-58923177 GAGGGGGAAGAGTGGAAGGAGGG + Intergenic
974274891 4:59705876-59705898 GAGGGTAAAGCACAGAAGGACGG + Intergenic
974309996 4:60192911-60192933 GAGGGTGAAGGGTAGAAAGAGGG + Intergenic
974531526 4:63114537-63114559 GAGGGAGGAGAGGAGAAGGAGGG - Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974994780 4:69141373-69141395 GAGGGAGAAAAGAAGAGGGAAGG - Intronic
975139344 4:70903397-70903419 GAGGGGGAAGGGCAGAAGGATGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975987063 4:80210460-80210482 GAAGGAGAAGAGAAGAGGGACGG + Intergenic
976116216 4:81730395-81730417 GAGGTTGTAGAGAAAAAGGAAGG + Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977205461 4:94160601-94160623 GAGGGGTGAGAGAACAAGCATGG + Intergenic
977587302 4:98787817-98787839 GAGAGTTAGGTGGAGAAGGAAGG + Intergenic
977821219 4:101474280-101474302 GAGATTTAAGAAATGAAGGAAGG + Intronic
978501997 4:109419716-109419738 AAGGGGTAAGAGAGGAGGGAAGG - Intergenic
978743534 4:112165721-112165743 GAAGGTAGAGAGTAGAAGGATGG + Intronic
978849374 4:113315061-113315083 GAGGGATAAGAAAAGAAAGAAGG - Intronic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979440000 4:120740449-120740471 GTGGGTTTAGAGAGGAAGGAGGG - Intronic
979543260 4:121910671-121910693 GGGGGTGAGGAGAAGAAAGAAGG + Intronic
979663246 4:123282806-123282828 GGGGGAGAAAAGAAGAAGGAAGG + Intronic
979717971 4:123864527-123864549 GATGGTGAGGAGAACAAGGATGG - Intergenic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
979977475 4:127214455-127214477 GAGGGTTAGGGAAAAAAGGAGGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980405269 4:132346386-132346408 GAGGGTTGAAAGAGGAAGGAGGG + Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980726764 4:136771814-136771836 GAGGGATAAGAGAATGAGTAGGG - Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980888954 4:138793640-138793662 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
981102993 4:140851024-140851046 GATGTTTCAGAGAAGAAAGAAGG - Intergenic
981364171 4:143882719-143882741 GAGGATTAAAAGGAGAAGCATGG - Intronic
981550754 4:145938300-145938322 GAGGGGAAAGAGGAGAGGGAGGG + Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983435953 4:167715742-167715764 TACTGTTAAGAGAGGAAGGAAGG + Intergenic
984374509 4:178910610-178910632 GAGGGTTGAGGGTGGAAGGAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985330073 4:188822556-188822578 GAGGGCTCAGAGTAGAGGGATGG - Intergenic
985797395 5:1973118-1973140 AAGGAAGAAGAGAAGAAGGAAGG - Intergenic
986009667 5:3700806-3700828 GAGAAGGAAGAGAAGAAGGAGGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986635063 5:9812941-9812963 ATGGGTTATGAGCAGAAGGAAGG + Intergenic
986826954 5:11532282-11532304 GTGGGTTTGGAGAAAAAGGAGGG - Intronic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987222339 5:15803533-15803555 GAGGGAGATGAGAGGAAGGATGG - Intronic
987983045 5:25113200-25113222 GAGAGTGGAGAGTAGAAGGAGGG + Intergenic
987985853 5:25144707-25144729 GAAGGTTGAGACTAGAAGGAGGG - Intergenic
988445967 5:31286548-31286570 GAGAGTTAAGGGGAGAACGATGG + Intronic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
988848449 5:35154501-35154523 GAGGTTGCAGAGAAAAAGGAAGG + Intronic
989007067 5:36826830-36826852 GAGGGGGAAGGAAAGAAGGAGGG + Intergenic
989432488 5:41372057-41372079 GGGGGTAGAGAGAATAAGGATGG - Intronic
989621050 5:43384641-43384663 GAGGGTTAAGAAAAAAAAAAAGG - Intronic
989738967 5:44746772-44746794 GAGGGTTAAGGGTGGGAGGAGGG - Intergenic
989980404 5:50636593-50636615 GAGGGTCAAATGAAGAAGCATGG - Intergenic
990332484 5:54741274-54741296 GAGGTTTAAGACAAGAAGTCTGG + Intergenic
990823676 5:59873067-59873089 GAGGGACAAGAAATGAAGGAAGG - Intronic
990870820 5:60430239-60430261 AAGGGTGATGAGAAGAAGAAGGG - Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991021723 5:61986294-61986316 GAGGGATGAGAGAAGCAGGTTGG - Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991521953 5:67509792-67509814 GAGGGTGGAGAGTGGAAGGAGGG + Intergenic
992765533 5:79995595-79995617 GATGCTGGAGAGAAGAAGGATGG + Intronic
993119058 5:83753414-83753436 GAGGGTGAGGAGAAGCAGGTTGG + Intergenic
993339523 5:86706114-86706136 GAGGTTTCAGAGTAAAAGGAAGG - Intergenic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994141668 5:96348231-96348253 GAAAGGTAACAGAAGAAGGAAGG + Intergenic
994159419 5:96539493-96539515 GATGGTTAAAAGTAAAAGGATGG - Intronic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994628636 5:102253483-102253505 GAGGGAGAAGAGAAGAAGTGGGG + Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995778575 5:115751765-115751787 TTGCGTTAAGAGAAGAAAGAGGG + Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996163285 5:120194177-120194199 GAGGGAGAAGAGAGGAAGGGTGG + Intergenic
996166614 5:120231564-120231586 GAGGGTGGAGGGTAGAAGGAGGG - Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997793110 5:136780557-136780579 GAGGATTAAGAGCAGTAAGATGG + Intergenic
998826533 5:146107234-146107256 GAGGGGCAAAAGAGGAAGGAGGG + Intergenic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999247271 5:150161817-150161839 GAGGGGTAGGAGGAGAAGAAAGG + Intergenic
999401890 5:151271183-151271205 GTGGGTTTAGAGTAGAAAGAAGG + Intergenic
999449702 5:151668780-151668802 GAGGGTTGGGGGAAGAAGCATGG - Intronic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
999739495 5:154539305-154539327 GAGGGAGGAGAGAGGAAGGAAGG - Intergenic
1000100392 5:158010824-158010846 GAACATTAAGAAAAGAAGGAAGG - Intergenic
1000850561 5:166334998-166335020 GAGTATGAAGAGAAGAAAGAAGG + Intergenic
1000930843 5:167249445-167249467 GAGGGGGAAGGAAAGAAGGAAGG - Intergenic
1000997608 5:167974372-167974394 GAGGGAGAAGGAAAGAAGGAAGG + Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001178868 5:169499614-169499636 GAGGGTAAAGGGTGGAAGGAGGG - Intergenic
1001208611 5:169788983-169789005 GAGGGTGGAGAGTAGAAGGAGGG - Intronic
1001320934 5:170680906-170680928 GAGGGGTAGGAGTGGAAGGAAGG + Intronic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002359522 5:178659699-178659721 GTGGGTTATGAGATGAAGGATGG + Intergenic
1003424007 6:5984451-5984473 GTGGGGTAAGAGAAAAAGGCAGG + Intergenic
1003505075 6:6734072-6734094 GAGGGTGAAGAGAACAGGGAGGG - Intergenic
1003850658 6:10219129-10219151 GAGAGGAAAGAGGAGAAGGAGGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005126850 6:22456574-22456596 AAGGGTTAAAAGTAAAAGGATGG + Intergenic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1006679808 6:35788677-35788699 GAGGGACAAGAAAAGAAGGAAGG + Intronic
1006916363 6:37596528-37596550 CAGGTTTAAAAGAAGAAGGTGGG + Intergenic
1007012984 6:38435579-38435601 GAGGGAAAAGAAAAGAAAGAAGG - Intronic
1007029479 6:38615130-38615152 GAAGGTGAAAAGAAGAAGCATGG - Intronic
1007264989 6:40589094-40589116 GAAGGGGAAGGGAAGAAGGAGGG + Intergenic
1007339434 6:41181153-41181175 GAGGATGGAGAGAAGAAGGGTGG - Intergenic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007692113 6:43709138-43709160 GAGGGGGAAGAGGGGAAGGAGGG - Intergenic
1007863823 6:44945234-44945256 GAGGCCTGAGAGAAGAAAGATGG - Intronic
1008056516 6:46951310-46951332 GAGGGAGAAGAGAAGAAGGCTGG + Intronic
1008117108 6:47564532-47564554 AAGGGTTAAACAAAGAAGGAAGG - Intronic
1008437905 6:51497631-51497653 GAGGGATGGGAGAAGAAAGAAGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009435436 6:63612928-63612950 GAGAGTGAAGAGAAAAAGGTGGG - Intergenic
1009552032 6:65109812-65109834 GAGGGTGAATAGAAGTAGGCAGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009867744 6:69418363-69418385 GAGGTATAAGAGAAGAAAGCTGG - Intergenic
1010211936 6:73369117-73369139 GAAGGTTAAGGGAGGATGGAAGG + Intronic
1010330131 6:74613965-74613987 GAAGGTGGAGAGAAGAAGGAGGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1012477010 6:99624658-99624680 CATGGTTAAAAGGAGAAGGAAGG + Intergenic
1012814004 6:103999090-103999112 GAGGGTGGAGGGCAGAAGGAGGG - Intergenic
1012848900 6:104424097-104424119 GAGAGATGAGTGAAGAAGGAAGG + Intergenic
1013171190 6:107637673-107637695 GAGGCTGAAAAGAAGAAGAATGG + Intronic
1013373770 6:109494393-109494415 AAAAGTTAAGAGAAGAAAGAAGG + Intronic
1013764843 6:113562652-113562674 GAAGGTTAAGAGAGGCAGGCCGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014484120 6:121978088-121978110 GAGCTTTAAGAGAATAGGGAGGG + Intergenic
1014657745 6:124129256-124129278 GAGGAGAAAGGGAAGAAGGAAGG + Intronic
1014662278 6:124187778-124187800 GAGGGTCAAGAGGAAAAAGAAGG - Intronic
1015025870 6:128531941-128531963 GAGGGTTAAGAGAAAAGAAAAGG - Intergenic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1015241865 6:131033256-131033278 GAGGGAGAAGGAAAGAAGGAAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015458979 6:133466675-133466697 AAGAGTTAGGTGAAGAAGGAGGG + Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1015463201 6:133517223-133517245 GAGGGTGGAGAATAGAAGGAGGG + Intronic
1015470888 6:133604947-133604969 GAGGGTTGAGGGTGGAAGGAGGG - Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015675330 6:135739888-135739910 TAGGATGAAGAGCAGAAGGAGGG + Intergenic
1015679303 6:135786286-135786308 GAGGGTAGAGGGTAGAAGGAAGG + Intergenic
1015992638 6:138962774-138962796 GAGAGTCCAGAGAATAAGGAAGG + Intronic
1016091583 6:139985690-139985712 GAGGAGTGAGAGAGGAAGGAGGG - Intergenic
1016547323 6:145239008-145239030 GAGGGGGAAGGAAAGAAGGAAGG - Intergenic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1017238258 6:152139605-152139627 GAGGGGGGAGAGAGGAAGGAAGG + Intronic
1017741277 6:157408995-157409017 GATGGAAAAGAAAAGAAGGAGGG + Intronic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018001275 6:159580711-159580733 GGAGGTGAAGGGAAGAAGGAGGG + Intergenic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018323304 6:162636465-162636487 GAGGGTAAAGAGATGACTGAAGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018979553 6:168592191-168592213 GAAGATTGAGAGAAGCAGGATGG - Intronic
1019320738 7:414283-414305 GAGGGGAAGGAGGAGAAGGAGGG - Intergenic
1019517529 7:1446466-1446488 GAGGATAGAGAGGAGAAGGAAGG + Intronic
1020202779 7:6093267-6093289 GAGAGAGAAGAAAAGAAGGAAGG - Intergenic
1020512388 7:9074123-9074145 GAGGGTGAAGGGTGGAAGGAGGG - Intergenic
1020737324 7:11967328-11967350 GAGGATTGAGAGATGAAGGTGGG + Intergenic
1021094733 7:16523058-16523080 GATGGTAAAGAGAAAAATGAAGG + Intronic
1021098779 7:16564072-16564094 GAGGGGAAAGAGAAGACGAAGGG + Intronic
1021795020 7:24245779-24245801 GAGGGGCAAGAGGAGAAGCAGGG + Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022043001 7:26598112-26598134 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022289416 7:28986582-28986604 GTGGGTAAAGAGAACAGGGAAGG + Intergenic
1022420459 7:30216160-30216182 GAGAGGAAAGAAAAGAAGGAAGG + Intergenic
1022431424 7:30326278-30326300 GAGGGTGGAGAGTAGGAGGAAGG - Intronic
1023110283 7:36803335-36803357 AAGTTTTAAGAGAAAAAGGAAGG - Intergenic
1023201489 7:37702309-37702331 GAGGGAAAAGGGAAGAAGAAAGG - Intronic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1023370375 7:39507042-39507064 GAGAGAGAAGAGAGGAAGGAAGG + Intergenic
1024173252 7:46811519-46811541 GAGGGTGAAGAGCAGTGGGAGGG - Intergenic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024435441 7:49348268-49348290 GAGAGTGAAGGGGAGAAGGAGGG - Intergenic
1024646588 7:51376134-51376156 GAGGAGGAAGAGAAGAGGGAGGG - Intergenic
1025198702 7:56949411-56949433 GAGGGTGAAGGGAGGAGGGAAGG - Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1025673246 7:63627520-63627542 GAGGGTAAAGGGAGGAGGGAAGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1026254038 7:68695440-68695462 GAGTGTGAAGATATGAAGGATGG + Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026558730 7:71430252-71430274 GAGGTGTAAGATAAGAATGAAGG + Intronic
1026964566 7:74431024-74431046 GAGGGTTTGGAGAGGATGGATGG - Intergenic
1027026221 7:74853484-74853506 GAGGGTTAAGGGCAGAATTAGGG - Intergenic
1027061534 7:75090630-75090652 GAGGGTTAAGGGCAGAATTAGGG + Intergenic
1027256329 7:76433026-76433048 GGAGGGTAAGAGAAGAAGGCTGG + Exonic
1027775233 7:82456595-82456617 GAGAGTTAAAAGAAGAAGAAGGG - Intergenic
1027956355 7:84883558-84883580 GAGGGTGGAGGGTAGAAGGAGGG - Intergenic
1028723059 7:94056096-94056118 GAAGCTTAACAGAAGAAGAAGGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029215987 7:98950038-98950060 GAGGGTCAAAAGAAGAAGACAGG - Intronic
1030337858 7:108344942-108344964 GAGGGAGAAGATAAGAAGGAAGG + Intronic
1030376853 7:108762325-108762347 GAGGGTTGAGGGCAGGAGGAGGG + Intergenic
1030488231 7:110198725-110198747 GAAGATAAAGAGTAGAAGGAGGG - Intergenic
1030560999 7:111085966-111085988 GAGGGTTAAGAGTGGGAGGAGGG + Intronic
1030672324 7:112351512-112351534 GAGGGTCCAGAGAGGAAGGAGGG - Intergenic
1031091683 7:117364482-117364504 GAGGGCTGAGAGGAGAGGGATGG + Intronic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031316858 7:120269364-120269386 GAGGGTGGAGGGTAGAAGGAGGG + Intergenic
1031325156 7:120386751-120386773 GAAGGTTAAGACAATAAAGAGGG - Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031728397 7:125266083-125266105 GATGATAAAGAAAAGAAGGAAGG - Intergenic
1031960206 7:127982444-127982466 AAGGGATAAAAGAAGAATGAAGG - Intronic
1032389645 7:131547609-131547631 GATGGTGAAGAGAAGAAAAATGG - Intronic
1032439355 7:131930304-131930326 GAGGGTCAAGGGTAGAAGTAAGG + Intergenic
1032538898 7:132687195-132687217 GGGGGCTGGGAGAAGAAGGATGG + Intronic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1033150872 7:138913993-138914015 GAGGGAGAAGGAAAGAAGGAAGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033534307 7:142298189-142298211 GAGGGAGAAGAGAGGCAGGAGGG + Intergenic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034670881 7:152857306-152857328 AAGGCTTATGAGCAGAAGGAAGG + Intergenic
1034691385 7:153017217-153017239 GGGGGTTAATAGAAACAGGAGGG + Intergenic
1034978510 7:155461378-155461400 GAGGGAGGAGAGCAGAAGGAGGG - Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035319649 7:158020448-158020470 GAGGGACAAGAGGAGAGGGAGGG + Intronic
1035760050 8:2062259-2062281 GAGGGCTGAGGGGAGAAGGAAGG + Intronic
1035894942 8:3389259-3389281 GAGGGTTGAGGGTAGCAGGAAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036546085 8:9771289-9771311 GAGGGAGGAGAGAGGAAGGAAGG + Intronic
1036650057 8:10636505-10636527 GAGGGGGAAGGGAAGAAGGCGGG - Intronic
1037118524 8:15254879-15254901 GAGATTTAAGTGAATAAGGAAGG + Intergenic
1037128821 8:15383552-15383574 GAGTGTTTGGGGAAGAAGGAAGG - Intergenic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037994361 8:23341776-23341798 GAGGCCTGAGAGAAGAAGCAGGG + Intronic
1038307927 8:26421351-26421373 GGGGGTGGAGAGAAAAAGGAAGG + Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038672480 8:29593372-29593394 GAGGGTTCAGAAAAGAACCATGG - Intergenic
1038947019 8:32372570-32372592 GCGGGATAGGGGAAGAAGGAAGG + Intronic
1038985885 8:32809881-32809903 GAGAGTTAAAAGGAGAAAGATGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039396623 8:37231473-37231495 AAGGAATAAGAGAGGAAGGAAGG + Intergenic
1039744487 8:40411938-40411960 AAGGGTTATGAGATAAAGGAGGG + Intergenic
1040828202 8:51646606-51646628 TAGGTTTAAGAGAGGAAGGGAGG + Intronic
1041136567 8:54765413-54765435 GAGGGTCAGGAAAAGAAGCAGGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041565959 8:59279370-59279392 GAGGGAGAAGGGTAGAAGGAGGG + Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1042354485 8:67811377-67811399 CATGGTTATGAGAATAAGGAAGG + Intergenic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1043824436 8:84908528-84908550 CAGCCTTAAGAAAAGAAGGAAGG - Intronic
1044983227 8:97736341-97736363 GAGGGTGAAGGGAAGGGGGAGGG + Intergenic
1044997836 8:97854129-97854151 GGTGATTAAGAGAGGAAGGAAGG + Intergenic
1045083998 8:98660804-98660826 GAAAGTGAAGAGAAGAGGGAAGG - Intronic
1045116479 8:98988351-98988373 AAGGGTTAAGTGGAGAAGGATGG + Intergenic
1045155283 8:99462126-99462148 GAGAGTTAGGAAAGGAAGGAAGG - Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045600508 8:103709842-103709864 GATGGTTTATGGAAGAAGGATGG + Intronic
1045957321 8:107923939-107923961 GGGGGTTGAGAGTAGAAAGAGGG + Intronic
1046139541 8:110072340-110072362 GAGGGTAGAGGGTAGAAGGAGGG - Intergenic
1046531029 8:115445075-115445097 GAGGGTTCAGAGAAGGGTGATGG - Intronic
1047236475 8:123046370-123046392 GAGGGTCAAGAGACAAAGGAAGG + Intronic
1048066538 8:130975133-130975155 GAGAGGTGAGAGGAGAAGGAAGG + Intronic
1048085388 8:131172377-131172399 GAGGGTTAGGAGAAATAGAAAGG + Intergenic
1048418014 8:134248800-134248822 GGAGGTAAAGAGTAGAAGGATGG + Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1049072352 8:140365913-140365935 GAGGGTGGAGGGTAGAAGGAGGG - Intronic
1049073074 8:140372201-140372223 GCGCCTTCAGAGAAGAAGGAAGG + Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049457091 8:142698935-142698957 GAGGGTTGAGAGGAGAAAGCAGG + Intergenic
1049891621 9:74879-74901 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1051784011 9:20722016-20722038 GAGGGAGAAGGAAAGAAGGAAGG - Intronic
1051884434 9:21875544-21875566 GAGGGTTAAGGGTGGGAGGAGGG - Intronic
1052367141 9:27625057-27625079 CTGGGTTTAGAGACGAAGGAGGG + Intergenic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1052918004 9:33938950-33938972 GAAGGGGAAGAGAAAAAGGAAGG + Intronic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053202609 9:36163219-36163241 GAAGTTTAAGAAAAGAGGGAAGG - Exonic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053733049 9:41075973-41075995 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1054695373 9:68355586-68355608 GAGGCTGAAGAAAAGAAGAATGG - Intronic
1055151930 9:73011048-73011070 GAGGAGAAAGACAAGAAGGAAGG - Intronic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055782753 9:79837188-79837210 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1055833632 9:80413311-80413333 GAGTGTGAAGAGTGGAAGGAGGG - Intergenic
1056411516 9:86332545-86332567 GAAGGTTAAGGGTAGAAGGAGGG + Intronic
1056480671 9:87001441-87001463 TTGGGTTAAAAGAAGAAGGATGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1057292733 9:93817863-93817885 GAGGGTTAAGGGAAGAACACAGG - Intergenic
1058146620 9:101419145-101419167 GAGGGAAGAGGGAAGAAGGAAGG - Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058642307 9:107099541-107099563 GGGGGGTAAGAGTAGAAGCAGGG - Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1058836401 9:108861933-108861955 GAGCGTTAAGAGCAAAAGCAGGG - Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059084472 9:111285209-111285231 GGGGGTTAAGAGAGGGAGCAGGG - Intergenic
1059128942 9:111724265-111724287 GAGGGTTAGTAGTAGAAGAAAGG - Intronic
1059641096 9:116217885-116217907 GATGGCTAAGGGAAGAAGTATGG - Intronic
1059663101 9:116420830-116420852 GAGGGAGAGGAGGAGAAGGAGGG + Intergenic
1059778035 9:117495967-117495989 GAGGGTGAAGGGTTGAAGGAGGG - Intergenic
1059807879 9:117823910-117823932 GAAGGGTTGGAGAAGAAGGAAGG + Intergenic
1059987777 9:119836540-119836562 GAGGATTATTAGAGGAAGGATGG - Intergenic
1061213404 9:129206399-129206421 GAGGGTAAAGAGTAGACAGAGGG - Intergenic
1061236148 9:129343713-129343735 GATGGTGATGAGGAGAAGGATGG + Intergenic
1061313214 9:129777440-129777462 GAGGGTTGAGAGACAGAGGAGGG - Intergenic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1186838436 X:13460928-13460950 GAGAGGGAAGAAAAGAAGGAAGG + Intergenic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187587849 X:20683870-20683892 GAGGGATAAGTGACGAAGCATGG - Intergenic
1187587963 X:20684853-20684875 GAGGGATAAGTGAGGAAGCATGG - Intergenic
1187607328 X:20899913-20899935 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1187708053 X:22026832-22026854 GAGGGAGGAAAGAAGAAGGAAGG - Intergenic
1187708997 X:22035283-22035305 GAGGGGAAGGAGAAGAAGAAAGG - Intronic
1187791054 X:22950815-22950837 GAGTGCTAAGAGGATAAGGATGG - Intergenic
1188205908 X:27358317-27358339 AAAGGTGAAGAGAAGAAGGTAGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188775792 X:34216721-34216743 GAGGGTGGAGAGTAGAAGGAGGG + Intergenic
1188945026 X:36290047-36290069 GAGGAGGAAGAGAAGAGGGAGGG - Intronic
1189038200 X:37514769-37514791 TAGGGTAGAGACAAGAAGGAGGG - Intronic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1189289084 X:39872693-39872715 GAGGAGAAAGAGAAGAAGAAGGG - Intergenic
1189290614 X:39882962-39882984 AAGGGTTAAGAGAAGTCGGAGGG + Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189496669 X:41514861-41514883 GAGGGTTAAAAGAAGAGGGATGG - Intergenic
1189827099 X:44930951-44930973 GAGGGTCAAAACATGAAGGAGGG - Intronic
1189882940 X:45510927-45510949 GAGGGAAAAGGGGAGAAGGAGGG - Intergenic
1190071321 X:47282202-47282224 GAGGGAGAAAGGAAGAAGGATGG - Intergenic
1190454201 X:50610166-50610188 GAGGGATAAGAGGAGAATTAAGG - Intronic
1190630452 X:52380856-52380878 GCCGGATAAGGGAAGAAGGAGGG + Intergenic
1190902336 X:54689028-54689050 GAGGGTGAAGAGTGGAAGGAGGG + Intergenic
1191771635 X:64767041-64767063 AAGAGTTAAGAGCAGAAGTAGGG + Intergenic
1191850694 X:65583808-65583830 GAGGGTGAAGGGTGGAAGGAGGG - Intergenic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1192205370 X:69092396-69092418 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
1192244380 X:69360590-69360612 GAGGGGCAAGAGAAGAAGCAGGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192979210 X:76320148-76320170 GAGGTTTTGGAGAAAAAGGAAGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193826516 X:86233188-86233210 GAGGGTGAAGGGTGGAAGGAGGG + Intronic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194200357 X:90947469-90947491 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1194243201 X:91477179-91477201 GAGGTTTGAGGGTAGAAGGAGGG - Intergenic
1194427965 X:93763209-93763231 GAGGGATAAGAGCAAAATGAGGG + Intergenic
1194563628 X:95454060-95454082 GAGGGTGAAGGGCAGTAGGAGGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195468047 X:105202729-105202751 AAGGGTTAAGAGAATCAAGAGGG - Intronic
1195518530 X:105804952-105804974 GAGGAAGAAGAGAAGAGGGAGGG + Intergenic
1195519453 X:105814078-105814100 GAGGGCTAAGGGGAGACGGAAGG + Intergenic
1195529882 X:105941907-105941929 GAGGGGGAAGTAAAGAAGGATGG - Intronic
1196468414 X:115995952-115995974 GAGGTTGTAGAGAAAAAGGAAGG - Intergenic
1196517974 X:116635951-116635973 GGAGATAAAGAGAAGAAGGATGG + Intergenic
1196698426 X:118639199-118639221 GATGTTTTTGAGAAGAAGGAGGG + Intronic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1196909893 X:120474561-120474583 TGGGGTTAAGAGATGAAGGAGGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197397626 X:125946454-125946476 GAAGGAGAAGAAAAGAAGGAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197960670 X:132002497-132002519 GGGGGTTAAGGGAAGTAGAATGG - Intergenic
1198063210 X:133068251-133068273 GAGGGTAGAGGGAGGAAGGAGGG + Intronic
1198102111 X:133431146-133431168 GAAGGAGGAGAGAAGAAGGAGGG + Intergenic
1198702118 X:139408052-139408074 GAAGGTAGAGAGCAGAAGGATGG - Intergenic
1198778754 X:140210709-140210731 GAGGGTGAAGCGTAGGAGGAGGG + Intergenic
1199197985 X:145054665-145054687 GAGGGTTCAGGGTAGGAGGACGG + Intergenic
1199474998 X:148235397-148235419 GGAGGTAAAGAGCAGAAGGATGG + Intergenic
1199600641 X:149539611-149539633 GAGGGGTAGGAGAAGCGGGACGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1200546352 Y:4523864-4523886 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1200782535 Y:7229621-7229643 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201550410 Y:15211883-15211905 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic