ID: 1194728727

View in Genome Browser
Species Human (GRCh38)
Location X:97429304-97429326
Sequence GAGTCAGTGGTTTCTTGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194728722_1194728727 20 Left 1194728722 X:97429261-97429283 CCGCTTCATCAAATCACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 193
1194728723_1194728727 2 Left 1194728723 X:97429279-97429301 CCCTGCACATTGATTGCATTAAG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 193
1194728724_1194728727 1 Left 1194728724 X:97429280-97429302 CCTGCACATTGATTGCATTAAGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194728727 Original CRISPR GAGTCAGTGGTTTCTTGGTT AGG Intronic
902470906 1:16647164-16647186 GAGCCAGTGGGTTCGTGGATGGG - Intergenic
902487897 1:16760284-16760306 GAGCCAGTGGGTTCGTGGATGGG + Intronic
905507590 1:38492434-38492456 AAGTTAGTGGCTTCTTGGATAGG - Intergenic
907600529 1:55764492-55764514 AAGTCAGTGGTAGCTTGATTGGG - Intergenic
908083476 1:60605745-60605767 AAGTCAGTGGTAGCTTGATTCGG - Intergenic
908246748 1:62233403-62233425 GAGTTAATGGTTTGTTGGTGGGG - Intergenic
910323593 1:85977357-85977379 AATTCAGAGATTTCTTGGTTTGG - Intronic
912464353 1:109860602-109860624 AAGTCATTGGTTTCTTGATGGGG - Intergenic
912968747 1:114260555-114260577 GGCTCAGTGGTTTCCTGGTTGGG + Intergenic
913062729 1:115222726-115222748 GTGTCTGTGGTTTCTGGGTTAGG + Intergenic
919620432 1:199859080-199859102 CATTCACTGGTTTCTTAGTTGGG + Intergenic
920524261 1:206655098-206655120 GAGTCAGTGGTTTTTTATTTTGG + Intronic
923053774 1:230408795-230408817 TTGTCAGTGGTTTCTTAGCTAGG + Intronic
1063616498 10:7604659-7604681 GAATGAGTGAATTCTTGGTTGGG - Intronic
1064218745 10:13421519-13421541 CAGTCTGTGGTTTCTGGATTTGG + Intergenic
1064697155 10:17978942-17978964 GATTCAGTAGATTCTGGGTTGGG - Intronic
1065090633 10:22229400-22229422 GGGTCGGTGGTTTCTTTGCTTGG + Intergenic
1067997372 10:51289236-51289258 GCATCAGTGGTTTTTTGCTTAGG + Intronic
1068839750 10:61597494-61597516 GACCCAGTTGTTTATTGGTTAGG + Intergenic
1076094127 10:127716759-127716781 TTCTCAGTGGTTTCTTGTTTTGG - Intergenic
1076336719 10:129711617-129711639 TAGTCAAAGTTTTCTTGGTTTGG + Intronic
1077107094 11:846994-847016 GATTCAGAGCTTTCCTGGTTGGG + Intronic
1080267123 11:30413185-30413207 AATTCAGTGGCTTCCTGGTTAGG - Intronic
1081400718 11:42639375-42639397 GAGACAAAGGTTTCTTAGTTTGG - Intergenic
1082635740 11:55591246-55591268 AGGTCAGTGGTTTCTAGGGTTGG - Intergenic
1082799674 11:57405497-57405519 GAATGAGTGGATTCTTGTTTTGG - Intronic
1085585545 11:77701073-77701095 GAGGCAGTGGTTTCTTCTTCAGG + Exonic
1085954877 11:81379658-81379680 GAGGCAGTGGTTTGTTGGGTTGG + Intergenic
1088462995 11:110102515-110102537 AAGACAGTGGTTTCTTAATTTGG + Intronic
1090601653 11:128378714-128378736 GGGCCAGTGGTTTCTGGGTGTGG - Intergenic
1090813253 11:130266814-130266836 AAGACAGTGGTTTCTTGAGTTGG + Intronic
1091760372 12:3083536-3083558 GAGTGAGCAGTTTCTTGGTAGGG + Intronic
1093795928 12:23310518-23310540 GAGTCTGAGGTTTCATGGCTGGG - Intergenic
1095454912 12:42373013-42373035 GAGACAGTGGTATCTTAGATGGG - Intronic
1095950049 12:47776849-47776871 GACTCAGCAGTTTCTGGGTTAGG - Intronic
1096469594 12:51867994-51868016 GAGTCAGTGGCTTCTGGGCTGGG - Intergenic
1098602247 12:72345903-72345925 GTGTCAGATGTTCCTTGGTTGGG + Intronic
1099939063 12:89163408-89163430 ACGTCAGTGGTTTATTGGTGTGG - Intergenic
1100390820 12:94145356-94145378 GATTCAGTGGTTTCCTGCTGGGG - Intergenic
1100918473 12:99455235-99455257 GAGTCAGTGGCTACTTAGTAGGG - Intronic
1100964130 12:99994190-99994212 AAGTCAGTGGTAGCTTGGTGGGG - Intergenic
1102642030 12:114375306-114375328 GAGTCAGTGGCTTCAGGGATGGG - Intronic
1104469724 12:129019805-129019827 CAGTCAATGGTGTCTTGGTATGG - Intergenic
1105780837 13:23704159-23704181 AAGTCAGTGGCTTCTGAGTTAGG - Intergenic
1106438541 13:29744826-29744848 GAGGCAGTGGCTTCCTGGTCTGG - Intergenic
1107028874 13:35830848-35830870 GAGAAAGTGGTTTCTTAGCTTGG + Intronic
1107648581 13:42520882-42520904 AAGTCAGTGGTAGCTTGATTGGG - Intergenic
1109213474 13:59562380-59562402 AAATCAGGGATTTCTTGGTTTGG + Intergenic
1110316469 13:74114115-74114137 AAGTAAGTGGTTTCTTGAGTTGG + Intronic
1111024769 13:82505551-82505573 AAGGCAGTGGTTTGTTGTTTGGG - Intergenic
1113359096 13:109611945-109611967 GAGTCAGTGGTATTTTGGTATGG - Intergenic
1113447031 13:110377207-110377229 TTGTCAGATGTTTCTTGGTTAGG + Intronic
1113730062 13:112635304-112635326 GAGTCAGGGGCTTCTAGGGTGGG + Intergenic
1114059387 14:19005744-19005766 AAGTCAGTGGTATCTTGATGGGG - Intergenic
1114103160 14:19396007-19396029 AAGTCAGTGGTATCTTGATGGGG + Intergenic
1115806212 14:37054972-37054994 AAGTCACTGGTTTCTTGATTAGG - Intronic
1117239636 14:53816838-53816860 AAGTCAGTGGTTGCTTGATGGGG + Intergenic
1118877515 14:69797585-69797607 GATTCCTTAGTTTCTTGGTTGGG + Intergenic
1119519144 14:75272847-75272869 TAGTCAGTATTTTCCTGGTTTGG + Intergenic
1121257655 14:92542965-92542987 GAGTAAGGGGTTTCTTTGTGGGG + Intronic
1123587585 15:21773110-21773132 AAGTCAGTGGCCTCTTGGTGAGG - Intergenic
1123624223 15:22215675-22215697 AAGTCAGTGGCCTCTTGGTGAGG - Intergenic
1123798921 15:23801625-23801647 GAGTCTGAGGTGTCATGGTTTGG + Intergenic
1126177784 15:45754047-45754069 AAGTCAGTGGTAGCTTGATTGGG + Intergenic
1126732963 15:51702999-51703021 GGGTCAGTGCTCTCTTGGGTGGG + Intronic
1127194570 15:56569530-56569552 AAATCAGGGATTTCTTGGTTTGG - Intergenic
1127442148 15:59020422-59020444 GAGTCAGTTCTTTTTTGGTAGGG - Intronic
1128238840 15:66085812-66085834 AAATCAGGGATTTCTTGGTTTGG - Intronic
1128491374 15:68148989-68149011 GAGTCCTTGGTTTCTGGGTGGGG + Intronic
1128588071 15:68868720-68868742 GATACAGTTTTTTCTTGGTTTGG + Intronic
1128672055 15:69581125-69581147 GAGTGAGTGGTTGATTGGTCTGG - Intergenic
1134514556 16:14876293-14876315 GAGACAGGAGCTTCTTGGTTGGG - Intronic
1134600950 16:15533216-15533238 TAGACACTGGTTTCTTTGTTTGG + Intronic
1134702233 16:16274946-16274968 GAGACAGGAGCTTCTTGGTTGGG - Intronic
1134842658 16:17414101-17414123 GAGGCCCTGGTTTTTTGGTTTGG - Intronic
1134969597 16:18519704-18519726 GAGACAGGAGCTTCTTGGTTGGG + Intronic
1136910031 16:34136971-34136993 GTGTCTGTGGTTTCTGGCTTCGG - Intergenic
1138903603 16:61303506-61303528 GAGTCAGTGGTATTTTGTTATGG + Intergenic
1140986202 16:80160172-80160194 GGGTCAGTGGTTTCCTTGGTAGG + Intergenic
1141115071 16:81301446-81301468 GAGTTTGTGGTTTCTGGGGTTGG + Intergenic
1141963945 16:87428695-87428717 CAGTCAGTGGTTTCCTGGGGAGG - Intronic
1147313706 17:39608785-39608807 GAGTGAGAGGTTTCTAGGTTAGG - Intronic
1148250924 17:46079372-46079394 GAGTCAGATGTTTCCTGGGTGGG - Intronic
1152674920 17:81634899-81634921 GAGTCAAAGGTTTCTTGGCCGGG + Intronic
1153131103 18:1856500-1856522 GCGTCAGTGGTCTCATGCTTAGG - Intergenic
1154042019 18:10865402-10865424 GAGGCAGTGGCTGCTTGGTGAGG + Intronic
1154344838 18:13533011-13533033 GTGCCAGTGTTTTCTTGCTTCGG + Intronic
1154377657 18:13823085-13823107 GGGTGGGTGGTTGCTTGGTTTGG - Intergenic
1154377865 18:13823880-13823902 GGGTGAGTGGTTGCTTGGTTGGG - Intergenic
1155589673 18:27412094-27412116 AAGTCAGTGGTTCCTTGGGAAGG + Intergenic
1157305683 18:46515797-46515819 GAGACCGTGGTTTCTTGGGATGG - Intronic
1157519192 18:48333860-48333882 GAGACAGTGTTTTCAAGGTTGGG - Intronic
1158780712 18:60647377-60647399 GAGTCATTGGTTGCTTGATGGGG - Intergenic
1162698075 19:12492539-12492561 GTGTCATTGGTATCTTGATTGGG - Intronic
1164794509 19:31015122-31015144 TAGGCAGTGGATTCCTGGTTAGG + Intergenic
1166129420 19:40737153-40737175 GAGTCAGTGGTCTTCTGCTTTGG + Intronic
1166585705 19:43946353-43946375 GATTCAGTTTTTTCCTGGTTCGG + Intergenic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1202703302 1_KI270713v1_random:3956-3978 GAGCCAGTGGGTTCGTGGATGGG - Intergenic
928474271 2:31609704-31609726 TAGGCAGTGGTTTCTTAGGTGGG + Intergenic
928695771 2:33848431-33848453 CTTTCAGTAGTTTCTTGGTTTGG - Intergenic
929180941 2:39038438-39038460 AAGAAAGTGGTTTCTTGGCTGGG + Intronic
930323921 2:49889037-49889059 GAGTATGAGGTGTCTTGGTTTGG + Intergenic
930634406 2:53788358-53788380 GTGTTAGGGGTTTTTTGGTTTGG + Intronic
930929746 2:56867183-56867205 AAGTCAGTGGTATCTTGATGGGG - Intergenic
931331163 2:61285628-61285650 ATGTCAGTGGTTTCTTGGGAAGG + Intronic
932736527 2:74258368-74258390 CAGACAGTGCTTTCTTGATTTGG - Intronic
935077334 2:99757848-99757870 GAGTCAACGGTGGCTTGGTTTGG - Intronic
935716586 2:105944280-105944302 GAGTGGGTGGTTTCTTAGCTAGG - Intergenic
937933817 2:127226463-127226485 GTGTCAGGGGTTTCTTGATTAGG - Intergenic
944435597 2:199685858-199685880 GAGTCTGTGGTTTCTTCAATTGG - Intergenic
944890203 2:204109649-204109671 GAGGCAGTTGTTTCCTGGTTGGG + Intergenic
944892831 2:204135444-204135466 CAGGCAGTGGATGCTTGGTTGGG - Intergenic
945371550 2:209024763-209024785 AAGTCAGTGGTAGCTTGATTGGG - Intergenic
1172824091 20:37765520-37765542 GAGCCACTGGTTTTTTGTTTAGG - Intronic
1174023248 20:47548970-47548992 AAATTAGTGTTTTCTTGGTTTGG + Intronic
1176116801 20:63435505-63435527 AAGTAAGTGGTTTCTTGGGATGG + Intronic
1177516254 21:22154834-22154856 GAGAAAGTTGTTTCTGGGTTTGG - Intergenic
1180295657 22:10932050-10932072 AAGTCAGTGGTATCTTGATGGGG + Intergenic
1180338917 22:11601810-11601832 GTGTCTGTGGTTTCTGGCTTCGG - Intergenic
1180477868 22:15728359-15728381 AAGTCAGTGGTATCTTGATGGGG - Intergenic
1181755777 22:25023590-25023612 GAATCATAGGTTTCTAGGTTTGG + Intronic
1184772256 22:46604527-46604549 GAGTCAGTGCTTTGTGGGTGCGG - Intronic
1185136812 22:49078019-49078041 GAGTCTGTGATTTCTGGGTATGG - Intergenic
950637635 3:14326170-14326192 GAGGCAAGGGTTTCTTGGTCAGG + Intergenic
952833773 3:37587512-37587534 GGGTGGGTGGGTTCTTGGTTTGG - Intronic
954076163 3:48182786-48182808 GAGTCAGAGAATTCTGGGTTTGG - Intronic
955570774 3:60303108-60303130 GAGAAAGTGGTTTCCAGGTTTGG - Intronic
956299140 3:67750532-67750554 GATTCATTGGTTTCTTTGTGTGG + Intergenic
957622630 3:82614171-82614193 GCGTCAGTTATTTCTAGGTTAGG - Intergenic
959346165 3:105197422-105197444 TACTCAGGGGTTTCTTGGTCTGG - Intergenic
960523008 3:118677462-118677484 GAGTCAGAGGCTTGCTGGTTTGG - Intergenic
960983637 3:123256427-123256449 GACTCAGAGGCTTCTTGTTTAGG - Intronic
963703052 3:148650606-148650628 GATTCTGTTGTTTTTTGGTTTGG + Intergenic
967983715 3:195080418-195080440 GGCTCTGTGGTTTCCTGGTTGGG - Intronic
969911370 4:10449840-10449862 GAGCCAGTGGAATCCTGGTTTGG - Intronic
972307087 4:37841406-37841428 GAATCAGTGGTTTCTTGCTAGGG - Intronic
973147166 4:46841599-46841621 GAGTGACTGTTTTCTTGTTTAGG - Intronic
978659788 4:111110935-111110957 GAGTCAGTGCTTTCCTTGTGTGG - Intergenic
980563589 4:134508564-134508586 GAGTCAGGGGGTTCTGTGTTTGG - Intergenic
981577392 4:146219175-146219197 GACATAGTGGTTTTTTGGTTTGG - Intergenic
981923217 4:150109752-150109774 TAGTCTGTTGATTCTTGGTTGGG - Intronic
984349082 4:178568785-178568807 CAATCAGTTGTTTCTGGGTTTGG - Intergenic
987120174 5:14759990-14760012 GAGTAAGTGGTTTCAAGGTGTGG + Intronic
988902335 5:35746308-35746330 AAATCAGGGATTTCTTGGTTTGG - Intronic
989685270 5:44078298-44078320 GAGACAGTGATTTCCTTGTTAGG + Intergenic
991397353 5:66218435-66218457 AAGTCAGTGGTTGCTTGATGGGG + Intergenic
991416786 5:66401066-66401088 GAGTCAGTGGTTGCTTGATGGGG + Intergenic
992280701 5:75173833-75173855 GAGTCATTGGTAGCTTGGTGGGG - Intronic
992740145 5:79765527-79765549 AAGTCAGTGGTAGCTTGGTGGGG + Intronic
994329937 5:98492675-98492697 AAGTCAGGGACTTCTTGGTTTGG - Intergenic
994347325 5:98701644-98701666 AATTCAGAGGTTTCTTGGTTTGG - Intergenic
996966237 5:129309419-129309441 TGGTCAGTGCTTTCTTAGTTGGG + Intergenic
997115132 5:131118369-131118391 AAGTCAGTGGTATCTTGATGGGG + Intergenic
997377797 5:133409637-133409659 GTGTCTGTGGTTTCAGGGTTGGG + Intronic
997994377 5:138574126-138574148 GAGTCAGTTTTTTCTTTTTTAGG - Exonic
1001086294 5:168702069-168702091 CAGTCAGAGGTTTCTTGGAGGGG + Intronic
1003654076 6:7989280-7989302 GAGACAGTGGATTCTTGCCTCGG + Intronic
1004250720 6:14021307-14021329 GAGTCTGTGTTTTCTTATTTGGG + Intergenic
1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG + Intergenic
1005049488 6:21671211-21671233 GGCTCAGTGGTTTCTTGATGAGG + Intergenic
1005067761 6:21835018-21835040 TAGTCTGTGGTTTCTGGTTTGGG + Intergenic
1005780818 6:29190042-29190064 AAGTCAGTGGTAGCTTGATTGGG + Intergenic
1007208281 6:40170331-40170353 GAGTCACTTGTATCTTAGTTTGG - Intergenic
1008395842 6:51005413-51005435 AAGCCAGTGATTTTTTGGTTTGG + Intergenic
1010531899 6:76978838-76978860 AAGTCAGTGGTATCTTGATGGGG + Intergenic
1011199452 6:84819108-84819130 AAGTCAGTGGTATCTTGATGGGG + Intergenic
1011875692 6:91958400-91958422 AAGTCAGTGGTAGCTTGATTGGG + Intergenic
1014673367 6:124334535-124334557 GAGTCAGTCGGTTCCTGGTGGGG + Intronic
1016503617 6:144751062-144751084 TAGGCATTGGTTTCATGGTTAGG + Intronic
1019818001 7:3215496-3215518 GAGTCTGTTGTTGGTTGGTTGGG - Intergenic
1022244702 7:28547467-28547489 GAGGCAGTTGTTTCTTCTTTGGG + Intronic
1023496475 7:40802692-40802714 GGCTCAGTGGTTTTTAGGTTGGG - Intronic
1025286437 7:57665979-57666001 AAGACAGTGGTTTCTTGGGATGG + Intergenic
1026614384 7:71888674-71888696 GAGTTAGTCGTTTCTAGGGTAGG + Intronic
1027918815 7:84363241-84363263 GAATCAGTTCTTTGTTGGTTTGG - Intronic
1028080704 7:86571781-86571803 GAGTCAGTGGTAGCTTGATGGGG - Intergenic
1028333214 7:89622335-89622357 GAGTAACTGCTTGCTTGGTTAGG + Intergenic
1030959074 7:115891927-115891949 AAGTCAGTGGTAGCTTGGTGGGG - Intergenic
1031307299 7:120146492-120146514 AAGTGAGTGGTTTCTTGATATGG - Intergenic
1032312133 7:130797845-130797867 AAGTCAGTGGTATCTTGATGGGG + Intergenic
1032366302 7:131303208-131303230 GAACCAGGAGTTTCTTGGTTTGG + Intronic
1032536644 7:132669933-132669955 GAGACAGTGATTGCTTTGTTAGG + Intronic
1034918583 7:155060596-155060618 TAGTCAGTGGGTTCTTGATCTGG + Intergenic
1035213378 7:157345906-157345928 GATGCACTGGTTTCTTGGTGAGG + Intronic
1036029338 8:4949622-4949644 GGGTCAGATGCTTCTTGGTTGGG - Intronic
1043014158 8:74917479-74917501 TAGTTTGTGGTTTCTTGGTTAGG + Intergenic
1043283645 8:78502025-78502047 AAGTCAGTGGTAGCTTGATTGGG + Intergenic
1044618232 8:94163852-94163874 GAGCCAGTGGGTTCTGGGTCTGG - Intronic
1044909065 8:97037591-97037613 GTCTCAGTGTTTTCTTGGTCTGG + Intronic
1045396066 8:101761853-101761875 GAGTAAGTGGTTTCTTTTTAAGG - Intronic
1046416953 8:113928879-113928901 GAGAAAGTGTTTTCTAGGTTTGG + Intergenic
1046758000 8:117991358-117991380 GAGCCAGTGGTTACTTTGTCCGG + Intronic
1048281638 8:133109902-133109924 GAGGCATTGGTATCTTGGCTAGG + Intronic
1048713466 8:137240276-137240298 GAGTCAGTGGTATTTTGTTTTGG + Intergenic
1052410841 9:28119234-28119256 GAGGCTGAGGTTTCTAGGTTGGG - Intronic
1055593422 9:77841850-77841872 GGCTCAGTGGTTTCTTGGTAAGG + Intronic
1057391211 9:94642832-94642854 GAGCCAATGGTTGCTTGGTGAGG - Intergenic
1058238726 9:102528279-102528301 GTTTCAGTGGTTTCAAGGTTAGG - Intergenic
1058590315 9:106558248-106558270 GAGTCAGTGGGTTCATTGGTGGG + Intergenic
1059565601 9:115380566-115380588 GAAAGAGTGGTTTCTTGGGTTGG - Intronic
1061837337 9:133338008-133338030 GAGTCAGTGGTTTCAAGGTCTGG - Intergenic
1062669058 9:137695638-137695660 TAGTTAGTGGGTTCTTGGCTAGG + Intronic
1185778753 X:2828693-2828715 CAGTCGGCGGTTTCTAGGTTTGG - Intergenic
1186354632 X:8777548-8777570 AAGTCAGTGGTAGCTTGATTGGG - Intergenic
1188766386 X:34097266-34097288 GAGTCAGTGGGTACTTAGATTGG - Intergenic
1189030719 X:37446904-37446926 CAGTCAGTGAATTCTTGCTTTGG - Intronic
1190465404 X:50721158-50721180 GAGTCAGTAGTTTCTGAGCTAGG - Intronic
1191161777 X:57337187-57337209 GATTCAATTATTTCTTGGTTCGG - Intronic
1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG + Intronic
1198526945 X:137510896-137510918 GAGTCAGTGGTAGCTTGATGGGG - Intergenic
1201309141 Y:12579116-12579138 CAGTCAGTGGTATCTTGATGGGG + Intergenic