ID: 1194735547

View in Genome Browser
Species Human (GRCh38)
Location X:97508854-97508876
Sequence AGAAATAGTTAGATTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194735547_1194735550 -6 Left 1194735547 X:97508854-97508876 CCAGCTTGAATCTAACTATTTCT 0: 1
1: 1
2: 1
3: 20
4: 195
Right 1194735550 X:97508871-97508893 ATTTCTCTTACGTAGTATAGGGG 0: 1
1: 0
2: 1
3: 10
4: 85
1194735547_1194735548 -8 Left 1194735547 X:97508854-97508876 CCAGCTTGAATCTAACTATTTCT 0: 1
1: 1
2: 1
3: 20
4: 195
Right 1194735548 X:97508869-97508891 CTATTTCTCTTACGTAGTATAGG 0: 1
1: 0
2: 1
3: 8
4: 91
1194735547_1194735549 -7 Left 1194735547 X:97508854-97508876 CCAGCTTGAATCTAACTATTTCT 0: 1
1: 1
2: 1
3: 20
4: 195
Right 1194735549 X:97508870-97508892 TATTTCTCTTACGTAGTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1194735547_1194735551 -5 Left 1194735547 X:97508854-97508876 CCAGCTTGAATCTAACTATTTCT 0: 1
1: 1
2: 1
3: 20
4: 195
Right 1194735551 X:97508872-97508894 TTTCTCTTACGTAGTATAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194735547 Original CRISPR AGAAATAGTTAGATTCAAGC TGG (reversed) Intronic
900148363 1:1167904-1167926 AGACAGTGTTAGAGTCAAGCTGG - Intergenic
900284510 1:1892548-1892570 AGAAATAGCTGGGTTCAGGCTGG - Intergenic
906005370 1:42464717-42464739 AGAAATAGTAAGATTCAACAAGG - Intronic
909182160 1:72438561-72438583 AGAATTAGTGAGCTTGAAGCAGG - Intergenic
912823767 1:112887339-112887361 AGAAATATATAGACTCAAGAGGG - Intergenic
917775339 1:178327962-178327984 AGAAATAGGAAGAGGCAAGCAGG + Intronic
918409860 1:184247287-184247309 AGAACTAGTGTGATTCTAGCTGG - Intergenic
920930448 1:210383041-210383063 AGAAAAAGTGAGCTTCAGGCCGG + Intronic
921423524 1:214976081-214976103 AGAGAAAGTAAGCTTCAAGCCGG + Intergenic
921889732 1:220341791-220341813 ACAAATAATTAGATTGAAGATGG - Intergenic
924221496 1:241880375-241880397 TGAAATAGTAAGATGCATGCTGG - Intronic
1063899302 10:10715818-10715840 AGAAATAGTGATATTTAAACTGG + Intergenic
1067919052 10:50434315-50434337 AGCAATAGTTGCATTCTAGCTGG - Intronic
1068006424 10:51396798-51396820 AGAAGTAGTTTGATTCCAGAGGG + Intronic
1068709058 10:60112342-60112364 AGAAAAAATCAGATTCAAGAAGG - Intronic
1070478346 10:76852611-76852633 AGAATTAGTGAGCTTGAAGCAGG + Intergenic
1071383281 10:85093172-85093194 AGTAATAGAAAGATTCAATCAGG + Intergenic
1072272853 10:93794311-93794333 AGAAAGAATTAGATTCCGGCCGG - Intronic
1072316473 10:94208275-94208297 AGAAATACTCAGAATGAAGCTGG - Intronic
1077871154 11:6262441-6262463 AGAAAAAGAGAGTTTCAAGCAGG + Intronic
1078595775 11:12685282-12685304 AGAGAGACTTAGATTCAGGCAGG + Intronic
1080302736 11:30802331-30802353 AGTTATAGTTACATTCATGCAGG + Intergenic
1082628454 11:55513270-55513292 AGAAATAATCAGATTGAAGTTGG - Intergenic
1082665353 11:55970004-55970026 AGGAATAGTCAGACTCAACCTGG + Intergenic
1084872808 11:72109385-72109407 AGGAATAGCTGGATGCAAGCTGG + Exonic
1087126443 11:94631062-94631084 ATAAATAGTTAAAATAAAGCTGG + Intergenic
1089851297 11:121498883-121498905 AAAAAAAGTTATATTCTAGCTGG + Intronic
1092233953 12:6793953-6793975 AGATATAGATAGATAGAAGCCGG - Intronic
1092859517 12:12708401-12708423 TGAAAAAATTAGATTCAAGAAGG - Intergenic
1092923262 12:13251222-13251244 AGAAATAATGAGCTTCAAACTGG + Intergenic
1097397734 12:59096323-59096345 AGATAAAACTAGATTCAAGCAGG + Intergenic
1097562608 12:61226486-61226508 GGAAATAGCTAGATACAACCTGG - Intergenic
1097741842 12:63252497-63252519 AGATAGAGTTAAATCCAAGCAGG - Intergenic
1098747128 12:74253045-74253067 AGAAATAGGTAGAAACAAGTTGG - Intergenic
1099596439 12:84672589-84672611 AGTAATAATTTGATTCAAACTGG - Intergenic
1100053572 12:90481491-90481513 AGAAATAGTGAGATGCAGACAGG - Intergenic
1100070768 12:90714286-90714308 AGAATAAGTGAGATTCAAGCTGG + Intergenic
1101180061 12:102206616-102206638 AGAAATAATTATATTTAAACAGG - Intergenic
1101707656 12:107235469-107235491 TGAAAGAGTTAGCTTCAGGCTGG + Intergenic
1102308659 12:111826609-111826631 AGAAATCGTTAGGATGAAGCTGG + Intergenic
1104098202 12:125580577-125580599 AGAAAGTGTGAGATTTAAGCAGG + Intronic
1104427908 12:128693197-128693219 AGAATTAGTGAGAATCATGCTGG + Intronic
1105383850 13:19912177-19912199 AGAAGTAGTTTGCTTCTAGCTGG + Intergenic
1112169053 13:96950812-96950834 AGAAGTAGTAAGACTCAAGCTGG - Intergenic
1115788560 14:36854324-36854346 AGAAATAGTTATAGTCGAGTTGG + Intronic
1115922841 14:38395790-38395812 AGAAATAGTGAGAATGATGCTGG - Intergenic
1117023035 14:51591450-51591472 AGAAATAGTTTGAATAATGCTGG - Intronic
1117267040 14:54100122-54100144 AGAAATTATTAGATTCAGGCCGG - Intergenic
1121110853 14:91311858-91311880 AAAAATAGTTTGATTCATGAAGG + Intronic
1122641095 14:103160099-103160121 AGAAATAGTTAAAAACAGGCCGG - Intergenic
1122750754 14:103930995-103931017 AAAAATTATTAGATTCAATCTGG + Intronic
1125436571 15:39651789-39651811 ACAAATTGTTAGATACAAGTTGG + Intronic
1126077713 15:44928940-44928962 AGATATAGATATATTCTAGCAGG - Intergenic
1126080941 15:44961255-44961277 AGATATAGATATATTCTAGCAGG + Intronic
1134356141 16:13483942-13483964 TAAATTAGTTAGATTCAAGGAGG + Intergenic
1134532633 16:14996191-14996213 AGAAATTGTTACATTCTAGAAGG - Intronic
1136597937 16:31264835-31264857 AAAAATAGGTCAATTCAAGCTGG - Intronic
1139501226 16:67367754-67367776 AGAAGAAGTTAGTTTCAGGCTGG + Intronic
1139863399 16:70044528-70044550 AGAAATTGTTACATTCTAGAAGG + Intergenic
1144216310 17:13058568-13058590 AGAAACAGTAAGAGTCAGGCCGG + Intergenic
1144604098 17:16648970-16648992 AAGGATAGTTAGATTTAAGCTGG - Intronic
1147019367 17:37519038-37519060 AGAAACAGACAGTTTCAAGCTGG - Exonic
1148377090 17:47158523-47158545 AGTAATAGTAATATTCAAGAAGG - Intronic
1151499717 17:74481048-74481070 AGAAATAGAAAGATTCCAGCTGG - Intronic
1157967078 18:52220365-52220387 AGAAATAGTAACACTGAAGCTGG - Intergenic
1158361409 18:56677995-56678017 AGAAATAGTGAGCTTGAAGATGG - Intronic
1159113299 18:64085270-64085292 AGAATGAGTAGGATTCAAGCAGG - Intergenic
1159702291 18:71643565-71643587 ATAATTTGATAGATTCAAGCTGG + Intergenic
1159984633 18:74827717-74827739 AGAAACAGTGACATCCAAGCAGG - Intronic
1161726191 19:5930558-5930580 AGAAATAGTTCCATTTAAGCGGG - Intronic
1168449183 19:56449891-56449913 AGAAATAGTGAGCTTGAAGATGG + Intronic
925804753 2:7637117-7637139 AAAAATATTTATATTCAGGCTGG - Intergenic
926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG + Intergenic
929896211 2:45962953-45962975 AGAAAAAGTTTAATTGAAGCAGG + Intronic
930716335 2:54597044-54597066 AGAAATATTTTAATCCAAGCAGG + Intronic
932448895 2:71797209-71797231 ACAAACAGTCAGAATCAAGCCGG - Intergenic
935625722 2:105170828-105170850 AGAAATAGTTAAAGTGAAACTGG + Intergenic
936796191 2:116206993-116207015 AGAAAAAGTTAGATTAAAGAAGG - Intergenic
937560720 2:123220397-123220419 AGAAATAGTGAGCTTGAAGATGG + Intergenic
938582519 2:132659823-132659845 AGAAATAGCTAGAGCCTAGCGGG - Intronic
938636150 2:133228531-133228553 AGAAATATATAGACTTAAGCTGG - Intronic
939112757 2:138028075-138028097 ACAAAGAGTTAGATTTAAGTAGG - Intergenic
939631267 2:144528919-144528941 AGGAGTACTTAGATTCAAGCTGG + Intergenic
940392286 2:153146353-153146375 AGAAATAGTTAGATTAAAGCTGG - Intergenic
943697405 2:190951032-190951054 AGAAAGATTTAGATTAAAGATGG + Intronic
946807829 2:223489444-223489466 AGAAATAGTTACACCTAAGCTGG + Intergenic
947858763 2:233343377-233343399 AAAAATAGTTATCTTCAGGCCGG - Intronic
948065357 2:235074683-235074705 GGAAATAGTTATATTAAAGATGG - Intergenic
948751117 2:240133887-240133909 AGAAATATTCAGATTAAATCTGG + Intronic
1170255880 20:14342629-14342651 AGAAATAATTAGATTTTAGCAGG + Intronic
1170365637 20:15595536-15595558 AGGAATAGTTAAATTAAGGCTGG + Intronic
1170869681 20:20193908-20193930 AGAAATAATTAGAATGAGGCTGG - Intronic
1172141746 20:32727250-32727272 AAAAATTATTAGATTCAGGCCGG + Intronic
1172687304 20:36765894-36765916 AGAACTAGTTAAATCCAGGCCGG + Intronic
1174494795 20:50931562-50931584 AGGAAAAGTTAGGTGCAAGCAGG - Intergenic
1174558157 20:51411361-51411383 AGAAATAATTAGGTTTAATCAGG - Intronic
1174569166 20:51488890-51488912 ATAAAGAATTACATTCAAGCTGG + Intronic
1175062034 20:56252286-56252308 AGAGATAGGGAGATTCAGGCTGG + Intergenic
949313423 3:2725513-2725535 GGAGACTGTTAGATTCAAGCTGG - Intronic
951289757 3:20861464-20861486 GGAAGTAGATAGATTCAGGCTGG + Intergenic
956903894 3:73745499-73745521 AGAAATTGTTACATGCAACCTGG - Intergenic
957242119 3:77672923-77672945 AAAAATAGTGAGATAGAAGCAGG + Intergenic
959356114 3:105331031-105331053 AGAAATAGGTAAATTCATGGTGG - Intergenic
960200207 3:114825052-114825074 GGAAATACTGAGATTCAAGTTGG + Intronic
960690326 3:120340552-120340574 ACAAAATGTTAGATTCAAGTTGG - Intronic
961096799 3:124163949-124163971 AGAAAAGGTTAGATTCAAGCTGG - Intronic
963273016 3:143303834-143303856 AAAAAGACTTAGATTCAGGCCGG + Intronic
963548754 3:146695036-146695058 AGAAATAGTTGGCTTTCAGCTGG - Intergenic
963640273 3:147852779-147852801 AGAAATAGTTTCATTCTTGCAGG - Intergenic
963915704 3:150857139-150857161 AGAAAAAGTTACATTCATTCTGG - Intergenic
963928752 3:150979472-150979494 AGAAAGAGTCAGATCTAAGCAGG - Intergenic
965835815 3:172851225-172851247 ATAAATAGTTACAATCAACCAGG + Intergenic
966011328 3:175081703-175081725 AGAAATGGTTAGGTTAAAGAGGG - Intronic
967492683 3:190111711-190111733 AGAAAGAGTCACATTCAAGTGGG - Intronic
969978123 4:11125703-11125725 AGAAATATTTATATTCAACAAGG - Intergenic
970533744 4:17008205-17008227 AGAAAGAGCTTGATTCAAGGTGG - Intergenic
970683989 4:18544350-18544372 GGAAATATTTAGATAGAAGCTGG + Intergenic
970849419 4:20583513-20583535 AAAAACAGTTAGGTTCAGGCCGG + Intronic
971238395 4:24864627-24864649 AGAAAGAGTTTAATTCACGCAGG - Intronic
972015002 4:34232559-34232581 AGAAATAGTGAGCTTGAAGATGG - Intergenic
972224172 4:36993109-36993131 AGAAATGCATAGATTCATGCAGG - Intergenic
972609466 4:40643394-40643416 GGAAATAATTAGATTCAAGAAGG + Intergenic
974285596 4:59863273-59863295 ATAAATATTTAGATACAAGAAGG - Intergenic
974294775 4:59983228-59983250 AGCCACTGTTAGATTCAAGCTGG + Intergenic
976530641 4:86148603-86148625 AGAAACAATTAGACTCAATCTGG + Intronic
976986830 4:91311003-91311025 AGAAATAGTTATACATAAGCAGG - Intronic
977088642 4:92639955-92639977 AGAAATCATAAGATTCAAGAAGG - Intronic
977171563 4:93768506-93768528 AGAAGTAGTTAAATTCAAATAGG - Intronic
977546499 4:98388188-98388210 TGAAATAGGTAGACTCAATCTGG + Intronic
978740126 4:112127605-112127627 AGAAAGAATTTGATTAAAGCAGG + Intergenic
979819832 4:125157281-125157303 AGAAATAAATAGTTTCAAGAAGG + Intergenic
980776399 4:137442214-137442236 ATAAATAGTTAGATAATAGCTGG + Intergenic
980918841 4:139061950-139061972 AGAAAAAGGCATATTCAAGCTGG - Exonic
981300573 4:143181595-143181617 AAAAATAGTTAGATTGAACTGGG + Intergenic
982778151 4:159463297-159463319 AGAAATAGATTGTTTGAAGCTGG + Intergenic
983181001 4:164649011-164649033 AGAAACAGTTACATTACAGCTGG - Intergenic
983539750 4:168896788-168896810 ATAAATAAATAAATTCAAGCTGG - Intronic
983586614 4:169362510-169362532 AGAGATATTTTGATACAAGCAGG - Intergenic
987286514 5:16463317-16463339 ACAAATAGTGAGATTTAATCTGG - Intronic
988647920 5:33115872-33115894 AGAAATAGATGGATTCAAATTGG - Intergenic
988666587 5:33335545-33335567 TGAAATACATAGATTCAAACAGG - Intergenic
989996646 5:50841301-50841323 AGAAATAGTTACATTTTAGATGG - Intronic
993289091 5:86041697-86041719 AGGAGTAGTTAGCTCCAAGCTGG - Intergenic
993423944 5:87738705-87738727 GGAAAAAGTCAGATTCAAGTAGG + Intergenic
993604766 5:89975537-89975559 GGAAACATTTAAATTCAAGCTGG + Intergenic
993972782 5:94440939-94440961 GGAAATAGTTAAACTCAATCTGG + Intronic
994042347 5:95273450-95273472 AGAAATAGTTATAATGAAGGAGG - Intronic
994276162 5:97840845-97840867 AGCTATAGTTAGATTCATGTAGG - Intergenic
994409906 5:99393998-99394020 AGAAATAACTAGAATCAGGCTGG + Intergenic
994426622 5:99596708-99596730 AGAAATAGGTAGATGACAGCAGG + Intergenic
994483917 5:100371277-100371299 AGAAATAACTAGAATCAGGCTGG - Intergenic
996136610 5:119850153-119850175 AGAAATAGACAAATTCAGGCCGG + Intergenic
996443254 5:123514428-123514450 AGGAATAGTTTAATTCAACCAGG + Intronic
997467097 5:134095554-134095576 AGAAAAAGTTAGATTACATCTGG - Intergenic
998595532 5:143526035-143526057 AGAAATAGTTAGCGTCAAACAGG + Intergenic
1000765482 5:165284215-165284237 AACAATAGTTAGATTCAAACAGG + Intergenic
1002756746 6:168160-168182 AGAAATACTTGTATTCAGGCTGG + Intergenic
1002914034 6:1514753-1514775 AGAAAAAGGCATATTCAAGCTGG - Intergenic
1006549046 6:34805286-34805308 AAAAATAGTTAAATATAAGCTGG + Intronic
1006659832 6:35631658-35631680 AAAAATAGTAAGATTGAGGCTGG + Intronic
1008403325 6:51090059-51090081 AATAATAATTAGAATCAAGCAGG - Intergenic
1008694753 6:54022464-54022486 ACAAAGAGATACATTCAAGCTGG + Intronic
1008816048 6:55568037-55568059 AGAATTATTTAGATTCATGGAGG - Intronic
1011059236 6:83244667-83244689 AGAAATAGTTACATACAATCTGG + Intronic
1011359570 6:86509536-86509558 TGAATTAGTTAGCTTCAAGCAGG - Intergenic
1011489142 6:87872632-87872654 AGAAACAGCTAGATTCATGGTGG - Intergenic
1012006985 6:93725481-93725503 AGAAATACTTGGATTCCAGCAGG + Intergenic
1013617638 6:111859610-111859632 AGTAATAGTTAAAATCAAACAGG + Intronic
1014442670 6:121491521-121491543 AGAAATAGTTTCATTCAGTCAGG + Intergenic
1014634500 6:123828567-123828589 AGACATAATTAGTTTTAAGCAGG - Intronic
1014659716 6:124154574-124154596 AGAAAGAGTTAGAGTTAAGGTGG - Intronic
1016192853 6:141292327-141292349 AGAAAAATATACATTCAAGCAGG - Intergenic
1018880569 6:167875382-167875404 AGAAATGGTTCGAGTAAAGCTGG - Exonic
1020471507 7:8540915-8540937 AGAAATAGTTTGATTCATTCTGG - Intronic
1020494586 7:8833357-8833379 AGAAATAGTAAGAGTTAACCAGG - Intergenic
1021061202 7:16115056-16115078 AAAAATAATTAGAATCAAGCAGG + Intronic
1023091496 7:36621698-36621720 AGAAATAGTTACCTTCTACCTGG + Exonic
1023175827 7:37434491-37434513 AGAAATGGTTAGATTCTAACAGG + Intronic
1024012809 7:45284709-45284731 AGGAACAGCTAGACTCAAGCAGG - Intergenic
1026793076 7:73347520-73347542 AGAAAGAGTTATATTATAGCAGG - Intronic
1027738260 7:81963563-81963585 AGAAATAATTAGATCCATGTCGG + Intronic
1032830187 7:135616464-135616486 AGAAATAATTAGATTAATGTTGG + Intronic
1032924331 7:136585718-136585740 AGAAATAGTGAGAGACAAGTAGG + Intergenic
1033067012 7:138165800-138165822 AGATATATTTAAATTCTAGCTGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034034937 7:147809258-147809280 AGGAAAAGTAAGATTCAAGATGG - Intronic
1034221452 7:149449626-149449648 AGAAATAGAGAGATTCTAGGTGG - Intronic
1034408473 7:150922600-150922622 AGAAATAGAAAGATGCATGCAGG + Intergenic
1036925675 8:12902737-12902759 AGAAGTTGTAAGATTCAAACTGG - Intergenic
1037576783 8:20213346-20213368 AAAAATATTAAGATTCTAGCAGG + Intronic
1040077387 8:43250890-43250912 AAAGATAGTCAGATTCAAGGAGG + Intergenic
1043719269 8:83525825-83525847 ATAAAAAGTAAGATTCAAGTAGG + Intergenic
1046296363 8:112224167-112224189 AGAAATAGAAAGATTCAAATTGG + Exonic
1046363819 8:113198939-113198961 AGAAATAATTTATTTCAAGCAGG - Intronic
1046695775 8:117337599-117337621 AGTAATACTTAGCTTCAGGCCGG - Intergenic
1047007493 8:120635852-120635874 AAAAATAGTTGTAGTCAAGCTGG + Intronic
1047641320 8:126824669-126824691 AGCAATAATTTGATTCATGCAGG - Intergenic
1051454993 9:17245776-17245798 AGAACTAGTTAGATTGAAGACGG - Intronic
1052227080 9:26102980-26103002 AGAAGTAGATAGATTCAAGTTGG + Intronic
1055223411 9:73965706-73965728 AGAAGTAGTTTGTTTTAAGCTGG + Intergenic
1055884827 9:81049334-81049356 AGAAATAGAAACCTTCAAGCAGG + Intergenic
1056252424 9:84763325-84763347 AAAAATGGTTAGATACAGGCAGG - Intronic
1056885141 9:90434840-90434862 AGAAATATTTAGTTTTATGCAGG - Intergenic
1057117027 9:92534307-92534329 AGAAGTACTGAGATTCAAGAGGG - Intronic
1059319141 9:113454312-113454334 AGAAACAGTTTGATCCTAGCTGG + Intronic
1059531486 9:115039538-115039560 GGAAATGGTCAGATTCATGCTGG - Intronic
1060960774 9:127679054-127679076 GGAAATGGTAAGATTCAAGAGGG - Intronic
1186521110 X:10207864-10207886 AGACATAGTTAGATTCCTCCAGG + Intronic
1186650409 X:11553891-11553913 TGAAATAGTTAAATTCATGTTGG - Intronic
1186746989 X:12580095-12580117 AAAAGCAGTTAGATTCAAGAGGG + Intronic
1186995996 X:15123026-15123048 AAAAATTGTAAGATTAAAGCAGG + Intergenic
1188625674 X:32281910-32281932 ATAAGTAGTTAAATTCAAGATGG - Intronic
1194735547 X:97508854-97508876 AGAAATAGTTAGATTCAAGCTGG - Intronic
1196327745 X:114428246-114428268 CGGAATAGTTTTATTCAAGCAGG + Intergenic
1197255512 X:124258616-124258638 AGAAATGGGTAGATTTAAGTAGG - Intronic
1198148404 X:133882372-133882394 AAAAATAGGCAAATTCAAGCAGG - Intronic
1199165266 X:144665598-144665620 ATAAATAGTTAAATTAAGGCAGG - Intergenic
1201065962 Y:10094275-10094297 AGAAATAGTGAGCTTGAAGACGG - Intergenic