ID: 1194736449

View in Genome Browser
Species Human (GRCh38)
Location X:97517814-97517836
Sequence ATCAGCCATATGTCCAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194736449 Original CRISPR ATCAGCCATATGTCCAACTT TGG (reversed) Intronic
901129608 1:6954065-6954087 ATCAGCCACATGTGCCATTTGGG + Intronic
904476871 1:30770788-30770810 ATCAGCCATTTCTCCAATGTAGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
906048506 1:42851655-42851677 TTCAGCGATATCTCCAACTTTGG + Exonic
910577892 1:88787732-88787754 ATCAGGCATTTTTCCCACTTTGG + Intronic
915258701 1:154658549-154658571 ATGAGCTAAATCTCCAACTTGGG - Intergenic
918792625 1:188849372-188849394 ATAAGCAATATGTACAATTTGGG + Intergenic
919656529 1:200202324-200202346 ATGTGCCATATGTTGAACTTGGG - Intergenic
1063253780 10:4303628-4303650 AGCAACCATCTGTCCAACCTTGG - Intergenic
1063646416 10:7888020-7888042 GTCACCCATCTGTCCAGCTTAGG + Intronic
1063947978 10:11195884-11195906 AAAAGCCATGTTTCCAACTTAGG - Intronic
1064483569 10:15763054-15763076 ATCAGCCATGCGTCCAACCTTGG + Intergenic
1067760003 10:49037818-49037840 GTCAGCCATTTGTCTATCTTTGG - Intronic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1071591272 10:86875633-86875655 ATTAGCCATATGTACAACAAGGG - Intronic
1079449167 11:20584490-20584512 AGCAGCCATTTGTCAAACTGAGG - Intergenic
1079864580 11:25719146-25719168 ACAAGCCAAATGTCCAACATTGG - Intergenic
1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG + Intergenic
1088207882 11:107415183-107415205 ATCAGACATATTTCCATCTTTGG + Intronic
1091176197 11:133560220-133560242 ATCATCCAAATGTCCAACAACGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093762950 12:22930711-22930733 AACAGTCATATGTCGAATTTAGG - Intergenic
1094539620 12:31352304-31352326 ATCAGTCACATGCCCAGCTTGGG + Intergenic
1095831685 12:46593379-46593401 ATTAGCCATTTGTACATCTTTGG + Intergenic
1096806198 12:54142695-54142717 AACATCCACATGTCCAATTTAGG - Intergenic
1097035444 12:56120749-56120771 ATGAGCGAGGTGTCCAACTTGGG + Exonic
1097176538 12:57146729-57146751 ATCAGACATGTGTCCTCCTTGGG + Intronic
1098171034 12:67747485-67747507 AGCAGCCATATGTGCAGCTCTGG + Intergenic
1098592791 12:72233184-72233206 ACCAGGAGTATGTCCAACTTGGG + Intronic
1099114858 12:78611328-78611350 GGCAGCCAAATGTACAACTTTGG + Intergenic
1100013768 12:89984283-89984305 ACCAGCCTTATGCCAAACTTTGG - Intergenic
1104364632 12:128165926-128165948 ACCAGCCAGCTGTGCAACTTGGG - Intergenic
1109605966 13:64695722-64695744 ATAAGCAATATTTCCACCTTGGG - Intergenic
1110772151 13:79362033-79362055 ATCATGCATATGTAGAACTTTGG - Intronic
1110988420 13:82004995-82005017 ATCAGCAATTTGTCCAAGGTGGG + Intergenic
1116912251 14:50481424-50481446 ATCAGCCAAATCTCCCATTTTGG + Intronic
1119178937 14:72591362-72591384 ATCAGCCATAATTCCACCTCTGG - Intergenic
1121078550 14:91089244-91089266 AACTGCCAAATGTCCAACTCAGG + Intronic
1121517015 14:94559296-94559318 TTCAGCCATGTGTACACCTTTGG + Intergenic
1125169088 15:36745367-36745389 ATTAACCATTTGTTCAACTTTGG + Intronic
1135957786 16:26970710-26970732 ATCGGCCATATGACCTGCTTTGG + Intergenic
1137439909 16:48489465-48489487 ATCAGCTGAATATCCAACTTAGG - Intergenic
1143924254 17:10355906-10355928 GTCAGCCATATGTGAAACTCAGG - Intronic
1146608452 17:34283723-34283745 ATCTGCCACATGTGCAACTCAGG + Intergenic
1149566832 17:57646148-57646170 CTCAGTCACATGTCCCACTTAGG - Intronic
1155420234 18:25647916-25647938 ATCACCCATAAGTTCCACTTTGG - Intergenic
1166125598 19:40714069-40714091 ATCAGCCGCTTGGCCAACTTTGG - Exonic
925103384 2:1268572-1268594 ATCAACCATAATTCCAATTTAGG - Intronic
925906295 2:8541458-8541480 AGCAGCCAGATGTCCAAATTTGG - Intergenic
928253921 2:29705625-29705647 CACAGCCAAATTTCCAACTTGGG - Intronic
928402702 2:30990817-30990839 ATCAGCCATATGTCTGCCTCAGG - Intronic
930453148 2:51570030-51570052 ATTAGCCCTATTTCCAACATTGG - Intergenic
931490797 2:62744671-62744693 ATCAGGCATATATACAGCTTAGG + Intronic
933552979 2:83797816-83797838 ATTAGCCATTTGTACATCTTTGG + Intergenic
936384790 2:112019654-112019676 CCCAGCCATATTTCCATCTTCGG - Intronic
938508262 2:131910067-131910089 ATGAGCCAAATTTACAACTTTGG - Intergenic
940071589 2:149694380-149694402 ATGAGCCATAAATTCAACTTGGG + Intergenic
947396034 2:229687784-229687806 ATTAGCCTTATGTCTAAATTTGG - Intronic
948587885 2:239031241-239031263 ATTAGCCATTTGTACAGCTTTGG + Intergenic
1169506685 20:6219244-6219266 GTCAGCCAGATATCCAACTTTGG + Intergenic
1170123248 20:12934698-12934720 ATGAGTCATATGTGCAAATTTGG - Intergenic
1170124562 20:12949096-12949118 ATGAGTCATATGTGCAAATTTGG - Intergenic
1175507851 20:59498681-59498703 ATCACAAATATGTCTAACTTAGG + Intergenic
1176785230 21:13248497-13248519 ATGAGCCAAATTTACAACTTTGG + Intergenic
1177983270 21:27942256-27942278 ATGAGCCAAATTTACAACTTTGG + Intergenic
1180604968 22:17051278-17051300 ATCAGCCAAATTTAAAACTTTGG + Intergenic
950167070 3:10809369-10809391 CTCAGCCATATGACTCACTTTGG - Intergenic
956763762 3:72466466-72466488 ATCAGCCTTCTGCCCAACATTGG - Intergenic
965432711 3:168609542-168609564 ACCAGCCAAATGTCGAAGTTGGG + Intergenic
966541996 3:181102277-181102299 ATGAGCCATATGTTCATTTTGGG - Intergenic
969511472 4:7620454-7620476 ATCAGGCATCTGTCCATCTGTGG + Intronic
970325737 4:14921209-14921231 ATCATCCATATGTGCAAATGAGG + Intergenic
970477593 4:16439417-16439439 ATAAGCCATTTTCCCAACTTGGG - Intergenic
971073024 4:23115953-23115975 ATCAGCCACACATCCAACTCAGG - Intergenic
974456738 4:62138622-62138644 ATCAGCCCCTTGTCCTACTTGGG + Intergenic
979220969 4:118224503-118224525 ATGACCCATTTGTCCAACTATGG + Exonic
982566489 4:156993367-156993389 ATCTGCCATATGCCTGACTTTGG - Intergenic
982684456 4:158471451-158471473 ATAAGCCAGACGTCCAACTCTGG + Intronic
983187613 4:164718439-164718461 ATAAGCCACATGCCCAGCTTGGG + Intergenic
983362298 4:166742654-166742676 TTCAGCCATATATGCAATTTAGG + Intronic
986536385 5:8792428-8792450 ATCAGCCCCATCTCCAACATTGG - Intergenic
993254403 5:85570302-85570324 ATTAGCCATTTGTACATCTTTGG + Intergenic
993425549 5:87759842-87759864 ATCAGCCATAGCATCAACTTTGG - Intergenic
995400867 5:111739619-111739641 ATCAGCCACGTGTCCATGTTTGG - Intronic
996446560 5:123560083-123560105 ATCAGCCATTTGTATATCTTTGG - Intronic
997443049 5:133922075-133922097 AGCAGCCATCTGTCCTTCTTTGG + Intergenic
997592276 5:135082231-135082253 CTCAGCCATATGTCTTGCTTTGG + Intronic
998484081 5:142486564-142486586 CTCATCCATATTTCCAGCTTGGG - Intergenic
999386296 5:151156610-151156632 GGGAGCCATATGTCCAAATTTGG + Intronic
999833916 5:155348892-155348914 ATCTGCCATATGTTCAACTTTGG - Intergenic
1000281295 5:159784683-159784705 ATCAGCCATCAGTTCTACTTTGG - Intergenic
1006418324 6:33918464-33918486 ATCAGCCAAATGTGCACCTCTGG + Intergenic
1007375510 6:41453469-41453491 ACCAGGCAAATGTCCAACTCTGG + Intergenic
1007995039 6:46298274-46298296 ATCAGTCATATTTACAACTACGG - Intronic
1008447526 6:51610347-51610369 GTCAGAGATATGTCAAACTTGGG - Intergenic
1011567366 6:88690808-88690830 AGTAGTCATATGTTCAACTTAGG - Intronic
1015615574 6:135071020-135071042 ATAAGCAATATGTTCAAATTTGG + Intronic
1015755298 6:136600142-136600164 ATCAACCACACATCCAACTTAGG + Intronic
1017083292 6:150689519-150689541 ATCATCCATCTGTCCATCTCAGG - Intronic
1022215918 7:28261392-28261414 TTCAGCAAGATCTCCAACTTTGG + Intergenic
1022629668 7:32072808-32072830 ATCAGCCATAACTCAAACTCTGG - Intronic
1024007372 7:45236405-45236427 AGCAACTATCTGTCCAACTTTGG + Intergenic
1026368751 7:69676649-69676671 TATAGCCATATGTCCATCTTGGG + Intronic
1031564519 7:123278846-123278868 ATCAGCAATATGGCTAACTTTGG + Intergenic
1032027438 7:128454921-128454943 ACCAGCCTTATGTCCAGATTTGG - Intergenic
1032425563 7:131819868-131819890 ATCATTCCTATGTCTAACTTGGG + Intergenic
1035143936 7:156794075-156794097 GACTGCCATTTGTCCAACTTGGG - Intronic
1040750899 8:50705824-50705846 GTCAGCCACAGGACCAACTTTGG - Intronic
1042004223 8:64163522-64163544 AACAGCCTTATGTACACCTTTGG + Intergenic
1043014823 8:74924768-74924790 ATAAGCCAAATGTCCATCATGGG - Intergenic
1043669020 8:82858202-82858224 ATCAGTCATATGCCCATCTGCGG + Intergenic
1045763336 8:105637021-105637043 AGCATACATTTGTCCAACTTAGG + Intronic
1047812944 8:128429983-128430005 ATCAGGCACATATCCAAATTAGG + Intergenic
1052635930 9:31104225-31104247 ATCTGCCACATGTTGAACTTTGG + Intergenic
1052952581 9:34225099-34225121 ATCAGTCAGATATCTAACTTTGG - Intronic
1057802284 9:98197816-98197838 ATCATCCCGATGACCAACTTAGG + Intergenic
1061813438 9:133177677-133177699 CTCAGCTATATGACAAACTTGGG + Intergenic
1188039774 X:25358252-25358274 ATCTGGCATATTTCAAACTTGGG + Intergenic
1188698633 X:33231184-33231206 AGCAATCATATGTACAACTTGGG + Intronic
1194736449 X:97517814-97517836 ATCAGCCATATGTCCAACTTTGG - Intronic
1196764638 X:119231826-119231848 AGCAGCCATATTTCCAATTCAGG - Intergenic
1198537151 X:137597830-137597852 AACAGCCTGATGCCCAACTTTGG - Intergenic