ID: 1194739983

View in Genome Browser
Species Human (GRCh38)
Location X:97560940-97560962
Sequence CTTCATATCATGAATGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194739981_1194739983 21 Left 1194739981 X:97560896-97560918 CCATTACATTAACAAGAATTTTC 0: 1
1: 0
2: 0
3: 24
4: 337
Right 1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG 0: 1
1: 0
2: 0
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194739983 Original CRISPR CTTCATATCATGAATGTAGA TGG Intronic
901042294 1:6372150-6372172 CTCCATAACATGAAAGTACAAGG - Intronic
901189125 1:7394570-7394592 CTTAATATCCAGAATGTATAAGG - Intronic
903760397 1:25693948-25693970 CTACATTTTATGAATGTATATGG - Intronic
908322975 1:62995901-62995923 CTTCATCTCATTAATATATATGG + Intergenic
911854762 1:102862258-102862280 GTTCATCTCATGAAGATAGAGGG - Intergenic
911987352 1:104644668-104644690 TTTCATATCATGAAAGTGCAAGG + Intergenic
912256760 1:108067482-108067504 CTTCAAAACATGAATGGATAGGG + Intergenic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
917061925 1:171050596-171050618 CATCATATCATCAGTGAAGAGGG + Intronic
918765381 1:188475600-188475622 CTTCAGTCCATGAATGTAGCTGG - Intergenic
921244799 1:213226357-213226379 CAACATATCAAGAATGTAAAAGG - Intronic
921446793 1:215256048-215256070 CTTTATTTCATGCATGTACAAGG + Intergenic
921529665 1:216265846-216265868 GTTGATCTCATGAAAGTAGAAGG + Intronic
922903089 1:229153352-229153374 CTTCATAACATGAAAGTACAGGG - Intergenic
1064675736 10:17758279-17758301 CATCAAATCATGAATGTTCAGGG - Intronic
1066343986 10:34564114-34564136 CTTCATTTCATGCATAGAGAAGG - Intronic
1067974826 10:51012417-51012439 CTTAATATGATGCTTGTAGAGGG - Intronic
1068072697 10:52215651-52215673 TTTCAAATCATGAATTTGGATGG + Intronic
1068645096 10:59457349-59457371 CTTCATAGCAGGAATTTAGGAGG - Intergenic
1070365166 10:75729686-75729708 CTTCAAATCATGATTGAACAAGG + Intronic
1072113649 10:92347691-92347713 CTTCCTATCTTGCATGTGGAAGG - Intronic
1073173084 10:101529712-101529734 TTTCCTATCAGGAAGGTAGATGG - Intronic
1074210748 10:111332049-111332071 CTTCATAACATAAAAGTACAAGG + Intergenic
1075596556 10:123734632-123734654 CTCCATAACATAAAAGTAGAGGG + Intronic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076310577 10:129504042-129504064 TTTCATTTCAGGAATGTAAAAGG - Intronic
1080648370 11:34203663-34203685 CTTCATTTCCTGTCTGTAGAGGG + Intronic
1082915829 11:58435716-58435738 CTGCCTATCATGAATGTGGGTGG - Intergenic
1085871596 11:80356839-80356861 CTTCTTAACATGAATCTACAAGG + Intergenic
1086269820 11:85048995-85049017 ATTCATATCATGGAGGTATAGGG - Intronic
1088385666 11:109252448-109252470 GTTCATCTCATTAAAGTAGAGGG - Intergenic
1092673468 12:10889666-10889688 CATCATATCATGAATATGAAAGG - Intronic
1094447070 12:30543002-30543024 CTTCATATAATGAATTTGGAAGG + Intergenic
1095228582 12:39705779-39705801 CTTCAAAAAATGAATATAGAAGG + Intronic
1097851626 12:64416389-64416411 CTTAATATCTGGAATTTAGAGGG + Intronic
1098401041 12:70076228-70076250 CTTCATAGCATGAATCTATTTGG - Intergenic
1104173650 12:126307236-126307258 AATCATATCATCAATGAAGAGGG + Intergenic
1105532873 13:21236123-21236145 CTTCTTCTCATGACTGGAGAGGG - Intergenic
1107065312 13:36208267-36208289 TTCCAAATCATAAATGTAGATGG - Intronic
1108866931 13:54935446-54935468 CTTTATCTCATGAATGAAGAAGG - Intergenic
1108896067 13:55330511-55330533 GTGCATATCACGAAAGTAGAGGG + Intergenic
1109585087 13:64389869-64389891 CTACATATAATTGATGTAGAAGG - Intergenic
1109701183 13:66026549-66026571 CTTCATAACATAAAAGTATAAGG + Intergenic
1110316407 13:74113167-74113189 CTGCATAACATAAAGGTAGAAGG + Intronic
1112214692 13:97418154-97418176 CTACATATCATGCATGTCCAGGG + Intergenic
1115308282 14:31954319-31954341 CTTCATAACATGAAAGTGCAAGG + Intergenic
1115746147 14:36439883-36439905 CTTCACATCATGACTGCACATGG - Intergenic
1119834148 14:77732485-77732507 CTTCCGATCAGCAATGTAGAGGG + Exonic
1125084213 15:35711718-35711740 CTTCATCTCTGGAATGGAGATGG + Intergenic
1125445697 15:39753312-39753334 CTTCATAAAATGAATGGGGATGG - Intronic
1125926487 15:43567463-43567485 CCTCATTTCAGGAATCTAGAAGG + Intronic
1125939631 15:43667028-43667050 CCTCATTTCAGGAATCTAGAAGG + Intronic
1126044185 15:44623248-44623270 ATACATATAATGAATGTAGGAGG - Intronic
1126828300 15:52572985-52573007 CTTCATAACATAAAAGTATAAGG + Intergenic
1127105770 15:55613094-55613116 CCTCATTTCATGGATGGAGAAGG + Exonic
1128104873 15:65036346-65036368 ATTCATTTCATGAATTTTGAGGG - Intergenic
1131020835 15:89096823-89096845 CTTCCTTTCATTAATGTAGAAGG - Intronic
1132778789 16:1611861-1611883 CTTCATAGCAAGAAAGCAGAGGG - Intronic
1140839591 16:78826581-78826603 CTTCATAGCAGAAAGGTAGAGGG - Intronic
1144023728 17:11259545-11259567 GTTCATATCCTGAATGCAGGTGG + Intronic
1147479806 17:40749476-40749498 CTTGATATCAGCAATGGAGAAGG - Intronic
1147621266 17:41869097-41869119 AATCTTATCCTGAATGTAGATGG - Exonic
1148141003 17:45328538-45328560 CTTCATATTTTGACTATAGATGG - Intergenic
1148976344 17:51533394-51533416 CTTCAATACATGAATGTGGAGGG - Intergenic
1149011628 17:51862954-51862976 CTTCAATACATGAATGTGGAGGG + Intronic
1149324926 17:55520270-55520292 CTTCATCTCAAGTATGTAGTAGG + Intergenic
1149622710 17:58058208-58058230 CTGCATGTCATGTATGTATATGG + Intergenic
1150226101 17:63525255-63525277 CTTCATTTCATAGATGTGGAAGG + Intronic
1151015894 17:70552342-70552364 CTTAATTTAATGAAAGTAGAAGG + Intergenic
1154300543 18:13187373-13187395 CTTCATAGCATGCAGGTATAAGG + Intergenic
1158133010 18:54173914-54173936 CATCATAACATGAAACTAGATGG - Intronic
1158223761 18:55178915-55178937 CTTCATTTCATGAATATTAAAGG + Intergenic
1158870410 18:61681753-61681775 CTCCATGTGGTGAATGTAGAGGG - Intergenic
1159838338 18:73368343-73368365 CATCATAACATGAAGGTACAAGG - Intergenic
1162297998 19:9826821-9826843 CGGCATATCATGAATGGAGGCGG + Intronic
1163815119 19:19460476-19460498 CTTCCTATCAGGAAGGAAGAAGG - Intronic
1164789936 19:30968092-30968114 CCTCGTATCAAGAATGTATAAGG + Intergenic
1166027978 19:40106400-40106422 TTTTATATTATCAATGTAGAGGG - Intergenic
1166139082 19:40796295-40796317 CTAAATATCATGAATCTGGATGG - Intronic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
926818498 2:16826272-16826294 CTTTATAACATAAATGTACAAGG - Intergenic
928852114 2:35760767-35760789 CTTCATAACATAAAAGTACAAGG + Intergenic
929178141 2:39002757-39002779 ATTTTTATCAAGAATGTAGAGGG + Intronic
929185868 2:39093979-39094001 CTTCAAATATTGAATGTAGGAGG + Intronic
929261174 2:39868096-39868118 CATCATATCAGTGATGTAGAAGG + Intergenic
935190339 2:100772569-100772591 CTTCACCACATGAATTTAGAGGG + Intergenic
935469748 2:103443965-103443987 TTTTATGTCATGAATGCAGAGGG + Intergenic
936676612 2:114723037-114723059 CTCCATCTCATGAATGTGCACGG - Intronic
938158681 2:128963419-128963441 CTCCATAACATAAAAGTAGAAGG + Intergenic
939027192 2:137028054-137028076 CTTCATATCATGAATTTTTAGGG + Intronic
939449071 2:142349082-142349104 CTTCCTATTTTAAATGTAGAGGG - Intergenic
940669149 2:156646185-156646207 GTTAATATCCTGAATGTATATGG + Intergenic
941733045 2:168940365-168940387 CTTCATATCATCAATAAAGCTGG - Intronic
941801823 2:169668156-169668178 CTCCATAACATAAATGTACAAGG - Intronic
944534748 2:200697556-200697578 CTTCATCTCAAGAAAATAGAAGG + Intergenic
945629966 2:212262174-212262196 ATTCAAATCATAAAAGTAGATGG + Intronic
945783595 2:214206318-214206340 GTTAATCTCATGAAGGTAGAGGG - Intronic
945989477 2:216382283-216382305 CTTCATAACATGAAAATACAAGG + Intergenic
946548299 2:220771324-220771346 AATCTTATTATGAATGTAGATGG - Intergenic
1174318706 20:49723255-49723277 GTTCATATCATGTCTGGAGATGG - Intergenic
1177526031 21:22291054-22291076 TTTCATTTTGTGAATGTAGAAGG + Intergenic
1178006833 21:28231065-28231087 CTTCATATTATTAATTTATATGG + Intergenic
1178082824 21:29082563-29082585 CTTGCTCTCATGAAAGTAGAGGG + Intronic
1178801976 21:35804542-35804564 CTTCATAGAATGAATTTAGGAGG - Intronic
1179047273 21:37857204-37857226 CCTCAGAACATGTATGTAGAGGG + Intronic
1179082266 21:38182381-38182403 ATTCATTACATAAATGTAGATGG + Intronic
1181392362 22:22593032-22593054 CTTCATTGCATGAATCTTGAGGG - Intergenic
1181820945 22:25475239-25475261 CGCCATTTCATGGATGTAGAAGG - Intergenic
1182253328 22:29019511-29019533 CTTCATGTCATGAATGCAAGTGG - Intronic
950685566 3:14616270-14616292 CTCCAAATCATGAAAATAGAAGG + Intergenic
952722637 3:36549139-36549161 CTACATATCTTGTATTTAGAGGG - Intergenic
954648302 3:52144595-52144617 TTTCATATCAAGAATTGAGAGGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
956860199 3:73315646-73315668 CTTGAAATCAAGAATGCAGAAGG + Intergenic
957160124 3:76600336-76600358 TTTCAAATCATTAATGTAGAAGG - Intronic
957707077 3:83802823-83802845 CTCCATAACATAAATGTACAAGG - Intergenic
957773861 3:84729873-84729895 CTTCCTGTCTTGAATGTAGAGGG - Intergenic
958599851 3:96282249-96282271 CTATATATCATGAATTTTGAAGG + Intergenic
958860816 3:99443881-99443903 ATATAAATCATGAATGTAGAGGG + Intergenic
959046593 3:101481435-101481457 GTTGATCTCATGAAGGTAGAGGG + Intronic
959789739 3:110344921-110344943 CTTCATTTCATTAATGTGAAAGG - Intergenic
960045875 3:113197668-113197690 TTTCAAATAATAAATGTAGAAGG - Intergenic
961960796 3:130853126-130853148 GTTCATATCATGACTGTAAATGG + Intronic
964870437 3:161308040-161308062 CTTCATAACATAAAAGTACAAGG + Intergenic
966953287 3:184845157-184845179 CTTGATTTCATGAATTTAAAAGG - Intronic
970161116 4:13190110-13190132 CTTCAGATCATGAGAGTAGCAGG - Intergenic
970507442 4:16745668-16745690 CTTCATAGCAGCAATGTCGAAGG + Intronic
972952325 4:44342802-44342824 CTTCATAGCATAAAAGTACAAGG - Intronic
973026037 4:45272525-45272547 TTTGATTTCATGAAAGTAGATGG + Intergenic
975837686 4:78441795-78441817 ATTCATATCATATATGTAGAAGG - Intronic
976122258 4:81796078-81796100 ATTTATATGATGAATCTAGAAGG - Intronic
976455396 4:85240878-85240900 CTTCATAGAATGAATTAAGAGGG + Intergenic
978122713 4:105099916-105099938 CTTCATAACATAAAAGTATAAGG - Intergenic
979114217 4:116800623-116800645 CTTGAAATCTTGAATGCAGAGGG + Intergenic
979439048 4:120729398-120729420 CTTCATCTCATGGATGTTGTGGG - Intronic
980266232 4:130520467-130520489 ATTAATATCATGAATTTAGGAGG - Intergenic
983134469 4:164063426-164063448 CTTCATAACATAAAAGTACAAGG - Intronic
983428350 4:167616124-167616146 GTTCATCTCATGAATATAGAGGG - Intergenic
985061813 4:186087791-186087813 CTTCAAATCAAGAACTTAGAAGG + Exonic
986407397 5:7439778-7439800 CTTCATGTCATGGATGAGGATGG + Intronic
986802560 5:11277319-11277341 ATTCACATCATCAATGAAGATGG + Intronic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
989466923 5:41767985-41768007 GTTCATATGATGAAACTAGATGG - Intronic
990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG + Intronic
990895642 5:60697951-60697973 CTTCTTTTCATGGATGCAGAGGG - Intronic
994024442 5:95066116-95066138 ATTAATATCCAGAATGTAGAAGG + Intronic
994456298 5:100012535-100012557 CTTCATATCAGGATTGAACAAGG - Intergenic
994999736 5:107112113-107112135 CTCCATTTCATGGATGAAGAAGG - Intergenic
996123752 5:119701865-119701887 CTTCATAACATGAATTAAGGAGG + Intergenic
997421534 5:133771664-133771686 CATCATATCATCAATGAACAGGG + Intergenic
998735753 5:145138736-145138758 ATTCATCTCAGGAATGCAGATGG - Intergenic
1001725448 5:173893950-173893972 CTTCATTACATGAATTCAGAGGG + Intronic
1007309701 6:40935541-40935563 CTTCAAAGGATGAATTTAGAAGG + Intergenic
1008743130 6:54634548-54634570 ATTCATATCATCACTGTATAGGG - Intergenic
1009584759 6:65585410-65585432 CCTCAATTCATGAATCTAGATGG + Intronic
1010111629 6:72241928-72241950 CTCCATATAATAAATGTAGGCGG - Intronic
1011951241 6:92967546-92967568 CTGCAGATAATGAATGTAGGTGG - Intergenic
1012334614 6:98039773-98039795 CTTCAGATGACGAACGTAGATGG - Intergenic
1013577160 6:111494975-111494997 CATCAAATGATCAATGTAGAGGG - Intergenic
1014955110 6:127605810-127605832 CTTCCTATGATGGATGTAAATGG + Intergenic
1017024888 6:150172980-150173002 CATCACATCATCAATGAAGAGGG - Intronic
1017331011 6:153198292-153198314 CAGGATATCATGACTGTAGATGG - Intergenic
1018283099 6:162208753-162208775 CTCCATAATATAAATGTAGATGG + Intronic
1018316934 6:162565734-162565756 ATACATATAATGAATGTAAAGGG + Intronic
1020394624 7:7700358-7700380 TTTCATTTCATGAATTTTGAGGG + Intronic
1021405148 7:20258194-20258216 CTTCAAATGTTGAATGTAGGTGG - Intergenic
1022513813 7:30962903-30962925 GATCACATCATGAATGTTGAAGG - Intronic
1026305847 7:69141111-69141133 CATCATATCATGATTTTAAAAGG + Intergenic
1029842669 7:103382945-103382967 CTTCTTAGCATGAATGTCAAAGG + Intronic
1031654818 7:124341706-124341728 CTTCATAACATGAAAGTGCAAGG - Intergenic
1031954799 7:127931462-127931484 CTTCATAACATAAAAGTACAGGG + Intronic
1032694812 7:134325801-134325823 CTTCATATGATTCATGTAGGAGG - Intergenic
1035516443 8:237497-237519 ATTAATATCATGAATGTAATTGG + Intronic
1037147947 8:15596180-15596202 CGTCATATCATTATTATAGATGG - Intronic
1037327784 8:17711388-17711410 CTTCATAACATGAAAGTACAGGG - Intronic
1037354997 8:18008913-18008935 CTTGACATAATAAATGTAGAGGG + Intronic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1041626655 8:60036656-60036678 CTTCATAACATAAAAGTACAAGG + Intergenic
1041765678 8:61415740-61415762 CTTCATCTCTTCAATGAAGAGGG - Intronic
1043068248 8:75603793-75603815 CTTCTTTTCATGAGAGTAGATGG + Intergenic
1043420866 8:80097284-80097306 CTCCATAACATAAATGTATAAGG + Intronic
1043687889 8:83110948-83110970 CTTCATAACAGGAAAGTATAAGG - Intergenic
1044937341 8:97305848-97305870 CTTCACATCATGAAGGATGAGGG + Intergenic
1047314150 8:123716725-123716747 CTTCTTCTCGGGAATGTAGATGG + Intronic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1050632340 9:7573340-7573362 CTTCATACCCTGGATGTCGATGG - Intergenic
1050860099 9:10417894-10417916 CTTCATTAAATGAATCTAGATGG + Intronic
1051329531 9:16009309-16009331 TTTGATATCAGGAATGCAGATGG - Intronic
1051713264 9:19954917-19954939 CTTAAAATTATGTATGTAGATGG + Intergenic
1056720867 9:89070620-89070642 CTTCACATCTTTAATGAAGAAGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1059118892 9:111623797-111623819 CTTCATATAAGGTATGTAAAAGG - Intergenic
1060592308 9:124825535-124825557 CTTCATATCATGCACTGAGAAGG - Intergenic
1186131345 X:6469212-6469234 CTTGACATCATAAATTTAGAGGG - Intergenic
1186706806 X:12148513-12148535 CTCCATAACATGAAAGTACAAGG + Intronic
1187026704 X:15442861-15442883 CTCCATAACATAAAAGTAGAAGG + Intronic
1190346627 X:49343287-49343309 CTTCCTATCATGTATGTTGCTGG + Intronic
1190347875 X:49534315-49534337 CTTCCTATCATGTATGTTGCTGG + Intronic
1190348976 X:49543871-49543893 CTTCCTATCATGTATGTTGCTGG + Intronic
1190350079 X:49553427-49553449 CTTCCTATCATGTATGTTGCTGG + Intronic
1190352282 X:49572538-49572560 CTTCCTATCATGTATGTTGCTGG + Intronic
1190353383 X:49582087-49582109 CTTCCTATCATGTATGTTGCTGG + Intronic
1191667579 X:63719222-63719244 ATTTATATCATTTATGTAGAAGG - Intronic
1192170178 X:68849513-68849535 CTTCATCTGTTGAATGTAAATGG + Intergenic
1193255244 X:79341038-79341060 CTTCATATGATTGATGTGGAGGG + Intergenic
1194277357 X:91901682-91901704 CTTCATTCCATGAATGTGGATGG + Intronic
1194591264 X:95802885-95802907 CTCCATAACATAAATGTACAAGG + Intergenic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1196306540 X:114109345-114109367 CTTAATATCATGACAGTTGATGG - Intergenic
1196575578 X:117314533-117314555 CTCTATATAATAAATGTAGAAGG - Intergenic
1197398857 X:125963897-125963919 CTTCATATAATGAGTTAAGAAGG - Intergenic
1197995630 X:132369466-132369488 CTTCATGTCATGAAGGTTAAAGG + Intronic
1199103460 X:143834895-143834917 CTACAAATGATGAATGTAAATGG + Intergenic
1200594696 Y:5123779-5123801 CTTCATTCCATGAATGTGGATGG + Intronic
1201369450 Y:13245915-13245937 CTTCATAACATGAATGTTTGGGG - Intergenic