ID: 1194741150

View in Genome Browser
Species Human (GRCh38)
Location X:97575793-97575815
Sequence CAATTGGATGAGCATACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194741147_1194741150 22 Left 1194741147 X:97575748-97575770 CCATTAGCATGCAGGAGATAGAA 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1194741150 X:97575793-97575815 CAATTGGATGAGCATACCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194741150 Original CRISPR CAATTGGATGAGCATACCCC TGG Intronic
902409926 1:16206639-16206661 CCATTGGAAGAGCAAACGCCTGG - Intronic
904579299 1:31528822-31528844 TAACTGGATGAGGATACCACTGG + Intergenic
905739129 1:40354212-40354234 CCCTTGGATGAGCATCCCTCTGG - Intronic
908487588 1:64610589-64610611 CTCTTGTATCAGCATACCCCTGG - Intronic
910953238 1:92673987-92674009 CAATTTGATGATCATACCAATGG + Intronic
911764211 1:101654816-101654838 CAAATGTATGTGCATACCCATGG + Intergenic
915250488 1:154584838-154584860 GAACTGGATTAGCAAACCCCAGG - Exonic
1066211724 10:33246618-33246640 CAAATGGATGTGGATTCCCCAGG - Intronic
1070501199 10:77073947-77073969 TAATTGGATGAGCATGCCTCTGG - Intronic
1089376819 11:118000368-118000390 CAAATGGAGTAGCATCCCCCTGG + Exonic
1106681003 13:32007612-32007634 CAAATGGATGACAACACCCCAGG - Intergenic
1108748452 13:53420479-53420501 TCCTTGCATGAGCATACCCCTGG + Intergenic
1110872025 13:80463481-80463503 CAACTAGATGAGAATAACCCAGG + Intergenic
1119186409 14:72645938-72645960 CACTTGCATGAGCATCCCCTGGG + Intronic
1119638044 14:76292732-76292754 CCATTGGCTGAGGATTCCCCCGG + Intergenic
1122032362 14:98921725-98921747 CAAGTGCATGAGGATGCCCCAGG + Intergenic
1122737160 14:103849402-103849424 CATTTGGATCACCTTACCCCGGG - Intergenic
1122994225 14:105253852-105253874 CAGTTTGGTGAGCAGACCCCAGG - Intronic
1123176425 14:106423142-106423164 GAATTGCATGAACATACCCTAGG + Intergenic
1123195003 14:106607537-106607559 CAATTGCATGAACATACCCTAGG + Intergenic
1123197279 14:106628661-106628683 GAATTGCATGAACATACCCTAGG + Intergenic
1123198623 14:106640537-106640559 GAATTGCATGAACATACCCTAGG + Intergenic
1123584417 15:21743940-21743962 GAATTGCATGAACATACCCTTGG + Intergenic
1123621064 15:22186551-22186573 GAATTGCATGAACATACCCTTGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1150686571 17:67325846-67325868 CACTTGGGTGAGCATCCGCCAGG - Intergenic
1155832856 18:30539916-30539938 AAATTGTATCAGCATACACCTGG + Intergenic
1160310946 18:77789449-77789471 CACTTGGCTGAGTATTCCCCTGG - Intergenic
1165144825 19:33724399-33724421 CTTTTAGATGAGGATACCCCCGG + Intronic
931192562 2:60019414-60019436 CATTTGGAGCAGCATTCCCCAGG - Intergenic
936693385 2:114919239-114919261 CAATTGGATGTGCATATCTCTGG + Intronic
936693488 2:114920645-114920667 CAATTGGATGTGCACATCTCTGG - Intronic
939610037 2:144298848-144298870 CAATTGGAGGAGTATACCATTGG - Intronic
941416588 2:165228961-165228983 CAATTGCATGATCCTACCCAAGG + Intergenic
942616225 2:177794495-177794517 CAATTCGATGAGCCTGCCTCTGG - Intronic
947664270 2:231893614-231893636 CCATGGGAAGAACATACCCCAGG + Intergenic
1169132278 20:3172590-3172612 CACTTGGCTGAGGACACCCCAGG + Intronic
1169575656 20:6957660-6957682 CCATTGTATGAATATACCCCTGG + Intergenic
1177067677 21:16461275-16461297 CAATTGGCTCAGCATTCCACAGG - Intergenic
1179025685 21:37676616-37676638 CAAGTGGATGAGCAAAACCAGGG + Intronic
956991083 3:74766337-74766359 CAATTGGATTCACAAACCCCAGG - Intergenic
960728474 3:120696839-120696861 ATATTTGATGTGCATACCCCAGG - Intronic
962937117 3:140091270-140091292 CAGCTGGAAGAGCATACCCTTGG + Intronic
962954380 3:140250678-140250700 CAATTGGATGAGCCTTCGCCAGG + Intronic
973318620 4:48787089-48787111 CAGTTACATGAGCATACCGCTGG + Intergenic
982047421 4:151462679-151462701 AAATTTGATGAGCATAGTCCTGG + Intronic
993516628 5:88844144-88844166 AAATTTAATGAGCATGCCCCAGG + Intronic
997221871 5:132174665-132174687 CCATTGGATGACCATACCATAGG - Intergenic
1008157925 6:48039883-48039905 AAATTGGATGAGTATAGTCCTGG + Intronic
1008190907 6:48455588-48455610 CAGTTGGATGAGAATGCTCCAGG - Intergenic
1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG + Intronic
1024642494 7:51341755-51341777 GAATTGGAGGAGCAAAGCCCTGG - Intergenic
1028988935 7:97028856-97028878 CAATTGGATGTGCATAATTCAGG + Intergenic
1036198454 8:6744805-6744827 CACTGGGATGGGCAGACCCCGGG - Intronic
1038060106 8:23903097-23903119 CCATTGTATGACCATAACCCAGG - Intergenic
1038980130 8:32750746-32750768 CAATTTGATGAGAAGCCCCCAGG + Intronic
1041943512 8:63415976-63415998 CAATTGCATGAGCAAATTCCTGG - Intergenic
1058003722 9:99893819-99893841 CAATTGGTAGAGAATATCCCAGG + Intergenic
1058194484 9:101955996-101956018 CAATAGGATTAGCAGCCCCCAGG + Intergenic
1061626661 9:131844431-131844453 CCATTGGATGAGCAGACCCAAGG - Intergenic
1062181553 9:135193745-135193767 CCAGTGGCTGAGCAGACCCCTGG + Intergenic
1194741150 X:97575793-97575815 CAATTGGATGAGCATACCCCTGG + Intronic
1201153449 Y:11107726-11107748 CAGTTGGTGGAGCATACCCTGGG - Intergenic