ID: 1194744491

View in Genome Browser
Species Human (GRCh38)
Location X:97613373-97613395
Sequence ACATCCTTCAGAATTTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194744488_1194744491 1 Left 1194744488 X:97613349-97613371 CCAAACTCTTCAGCTGAGTGGCC No data
Right 1194744491 X:97613373-97613395 ACATCCTTCAGAATTTGGCCTGG No data
1194744486_1194744491 23 Left 1194744486 X:97613327-97613349 CCAGTAAATAAAAAAATAAAGTC No data
Right 1194744491 X:97613373-97613395 ACATCCTTCAGAATTTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194744491 Original CRISPR ACATCCTTCAGAATTTGGCC TGG Intergenic