ID: 1194746273

View in Genome Browser
Species Human (GRCh38)
Location X:97631851-97631873
Sequence CTATCTCATGCTGAATGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194746272_1194746273 4 Left 1194746272 X:97631824-97631846 CCGATATACATATACTTTCTCAG No data
Right 1194746273 X:97631851-97631873 CTATCTCATGCTGAATGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194746273 Original CRISPR CTATCTCATGCTGAATGTAT AGG Intergenic
No off target data available for this crispr