ID: 1194756429

View in Genome Browser
Species Human (GRCh38)
Location X:97744127-97744149
Sequence TATAATGCAATATGAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756429_1194756436 8 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
1194756429_1194756434 4 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
1194756429_1194756441 21 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG No data
1194756429_1194756440 17 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756429_1194756435 7 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
1194756429_1194756432 3 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756429 Original CRISPR TATAATGCAATATGAGATTT GGG (reversed) Intergenic
No off target data available for this crispr