ID: 1194756431

View in Genome Browser
Species Human (GRCh38)
Location X:97744153-97744175
Sequence CCATGACACATGGGGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12787
Summary {0: 418, 1: 1219, 2: 2434, 3: 3877, 4: 4839}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756431_1194756442 9 Left 1194756431 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 1194756442 X:97744185-97744207 TGTGGAAGGCAATTTAATCATGG No data
1194756431_1194756440 -9 Left 1194756431 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756431_1194756443 10 Left 1194756431 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 1194756443 X:97744186-97744208 GTGGAAGGCAATTTAATCATGGG No data
1194756431_1194756441 -5 Left 1194756431 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756431 Original CRISPR CCATGACACATGGGGATTAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr