ID: 1194756432

View in Genome Browser
Species Human (GRCh38)
Location X:97744153-97744175
Sequence CCCATAATCCCCATGTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14811
Summary {0: 583, 1: 1483, 2: 2686, 3: 4340, 4: 5719}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756428_1194756432 6 Left 1194756428 X:97744124-97744146 CCACCCAAATCTCATATTGCATT No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719
1194756429_1194756432 3 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719
1194756427_1194756432 7 Left 1194756427 X:97744123-97744145 CCCACCCAAATCTCATATTGCAT No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719
1194756430_1194756432 2 Left 1194756430 X:97744128-97744150 CCAAATCTCATATTGCATTATAG No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719
1194756426_1194756432 8 Left 1194756426 X:97744122-97744144 CCCCACCCAAATCTCATATTGCA No data
Right 1194756432 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756432 Original CRISPR CCCATAATCCCCATGTGTCA TGG Intergenic
Too many off-targets to display for this crispr