ID: 1194756433

View in Genome Browser
Species Human (GRCh38)
Location X:97744154-97744176
Sequence CCCATGACACATGGGGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12692
Summary {0: 402, 1: 1210, 2: 2456, 3: 3865, 4: 4759}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756433_1194756440 -10 Left 1194756433 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756433_1194756443 9 Left 1194756433 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 1194756443 X:97744186-97744208 GTGGAAGGCAATTTAATCATGGG No data
1194756433_1194756442 8 Left 1194756433 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 1194756442 X:97744185-97744207 TGTGGAAGGCAATTTAATCATGG No data
1194756433_1194756441 -6 Left 1194756433 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756433 Original CRISPR CCCATGACACATGGGGATTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr