ID: 1194756434

View in Genome Browser
Species Human (GRCh38)
Location X:97744154-97744176
Sequence CCATAATCCCCATGTGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14394
Summary {0: 409, 1: 1259, 2: 2526, 3: 4365, 4: 5835}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756430_1194756434 3 Left 1194756430 X:97744128-97744150 CCAAATCTCATATTGCATTATAG No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
1194756427_1194756434 8 Left 1194756427 X:97744123-97744145 CCCACCCAAATCTCATATTGCAT No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
1194756426_1194756434 9 Left 1194756426 X:97744122-97744144 CCCCACCCAAATCTCATATTGCA No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
1194756429_1194756434 4 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
1194756428_1194756434 7 Left 1194756428 X:97744124-97744146 CCACCCAAATCTCATATTGCATT No data
Right 1194756434 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756434 Original CRISPR CCATAATCCCCATGTGTCAT GGG Intergenic
Too many off-targets to display for this crispr