ID: 1194756435

View in Genome Browser
Species Human (GRCh38)
Location X:97744157-97744179
Sequence TAATCCCCATGTGTCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16486
Summary {0: 444, 1: 1505, 2: 3073, 3: 5002, 4: 6462}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756430_1194756435 6 Left 1194756430 X:97744128-97744150 CCAAATCTCATATTGCATTATAG No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
1194756426_1194756435 12 Left 1194756426 X:97744122-97744144 CCCCACCCAAATCTCATATTGCA No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
1194756427_1194756435 11 Left 1194756427 X:97744123-97744145 CCCACCCAAATCTCATATTGCAT No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
1194756428_1194756435 10 Left 1194756428 X:97744124-97744146 CCACCCAAATCTCATATTGCATT No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
1194756429_1194756435 7 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756435 X:97744157-97744179 TAATCCCCATGTGTCATGGGAGG 0: 444
1: 1505
2: 3073
3: 5002
4: 6462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756435 Original CRISPR TAATCCCCATGTGTCATGGG AGG Intergenic
Too many off-targets to display for this crispr